Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYNLL2 cdna clone

DYNLL2

Gene Names
DYNLL2; Dlc2; DNCL1B; RSPH22
Synonyms
DYNLL2; Dlc2; DNCL1B; RSPH22; DYNLL2 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGTCTGACCGGAAGGCAGTGATCAAGAACGCAGACATGTCTGAGGACATGCAACAGGATGCCGTTGACTGCGCCACGCAGGCCATGGAGAAGTACAATATAGAGAAGGACATTGCTGCCTATATCAAGAAGGAATTTGACAAGAAATATAACCCTACCTGGCATTGTATCGTGGGCCGAAATTTTGGCAGCTACGTCACACACGAGACAAAGCACTTCATCTATTTTTACTTGGGTCAAGTTGCAATCCTCCTCTTCAAGTCAGGCTAG

Translation Sequence: MSDRKAVIKN ADMSEDMQQD AVDCATQAME KYNIEKDIAA YIKKEFDKKY NPTWHCIVGR NFGSYVTHET KHFIYFYLGQ VAILLFKSG
Sequence Length
89
Species
Human
Chromosome Location
17q22
OMIM Reference Number
608942
cDNA Size
270bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for DYNLL2 cdna clone
DYNLL2 (Dynein, Light Chain, LC8-Type 2) is a Protein Coding gene. Among its related pathways are Class I MHC mediated antigen processing and presentation and Vasopressin-regulated water reabsorption. GO annotations related to this gene include cytoskeletal protein binding and motor activity. An important paralog of this gene is DNAL4.
Product Categories/Family for DYNLL2 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
dynein light chain 2, cytoplasmic
NCBI Official Synonym Full Names
dynein light chain LC8-type 2
NCBI Official Symbol
DYNLL2
NCBI Official Synonym Symbols
Dlc2; DNCL1B; RSPH22
NCBI Protein Information
dynein light chain 2, cytoplasmic
UniProt Protein Name
Dynein light chain 2, cytoplasmic
Protein Family
UniProt Gene Name
DYNLL2
UniProt Synonym Gene Names
DLC2; DLC8b
UniProt Entry Name
DYL2_HUMAN

Uniprot Description

DYNLL2: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. May play a role in changing or maintaining the spatial distribution of cytoskeletal structures. Belongs to the dynein light chain family.

Protein type: Microtubule-binding; Motility/polarity/chemotaxis; Motor

Chromosomal Location of Human Ortholog: 17q22

Cellular Component: dynein complex; microtubule; centrosome; membrane; plasma membrane; myosin complex; nucleus; cytosol

Molecular Function: protein binding; cytoskeletal protein binding; motor activity

Biological Process: apoptosis; metabolic process; transport; organelle organization and biogenesis; antigen processing and presentation of exogenous peptide antigen via MHC class II; synaptic target recognition; microtubule-based process

Research Articles on DYNLL2

Similar Products

Product Notes

The DYNLL2 dynll2 (Catalog #AAA200755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGTCTGACC GGAAGGCAGT GATCAAGAAC GCAGACATGT CTGAGGACAT GCAACAGGAT GCCGTTGACT GCGCCACGCA GGCCATGGAG AAGTACAATA TAGAGAAGGA CATTGCTGCC TATATCAAGA AGGAATTTGA CAAGAAATAT AACCCTACCT GGCATTGTAT CGTGGGCCGA AATTTTGGCA GCTACGTCAC ACACGAGACA AAGCACTTCA TCTATTTTTA CTTGGGTCAA GTTGCAATCC TCCTCTTCAA GTCAGGCTAG Tr anslation Sequence: MSDRKAVIKN ADMSEDMQQD AVDCATQAME KYNIEKDIAA YIKKEFDKKY NPTWHCIVGR NFGSYVTHET KHFIYFYLGQ VAILLFKSG. It is sometimes possible for the material contained within the vial of "DYNLL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.