RPA2 cdna clone

RPA2

Cat. Num. AAA200657

• Gene Names: RPA2; REPA2; RPA32; RP-A p32; RP-A p34
• Synonyms: RPA2; REPA2; RP-A p32; RP-A p34; RPA32; RPA2 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA; ; Translation Sequence: MWNSGFESYG SSSYGGAGGY TQSPGGFGSP APSQAEKKSR ARAQHIVPCT ISQLLSATLVDEVFRIGNVE ISQVTIVGII RHAEKAPTNI VYKIDDMTAA PMDVRQWVDT DDTSSENTVVPPETYVKVAG HLRSFQNKKS LVAFKIMPLE DMNEFTTHIL EVINAHMVLS KANSQPSAGRAPISNPGMSE AGNFGGNSFM PANGLTVAQN QVLNLIKACP RPEGLNFQDL KNQLKHMSVSSIKQAVDFLS NEGHIYSTVD DDHFKSTDAE
• Sequence Length: 270

• Species: Human
• Chromosome Location: 1p35
• OMIM Reference Number: 179836
• cDNA Size: 813bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for RPA2 cdna clone

As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates, that form during DNA replication or upon DNA stress. It prevents their reannealing and in parallel, recruits and activates different proteins and complexes involved in DNA metabolism. Thereby, RPA2 plays an essential role both in DNA replication and the cellular response to DNA damage. In the cellular response to DNA damage, the RPA complex controls DNA repair and DNA damage checkpoint activation. Through recruitment of ATRIP activates the ATR kinase a master regulator of the DNA damage response. RPA2 is required for the recruitment of the DNA double-strand break repair factors RAD51 and RAD52 to chromatin in response to DNA damage. Also recruits to sites of DNA damage proteins like XPA and XPG that are involved in nucleotide excision repair and is required for this mechanism of DNA repair.

Product Categories/Family for RPA2 cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 4506585
• NCBI GeneID: 6118
• NCBI Accession #: NP_002937.1
• NCBI GenBank Nucleotide #: NM_002946.4
• UniProt Accession #: P15927
• NCBI Official Full Name: replication protein A 32 kDa subunit isoform 1
• NCBI Official Synonym Full Names: replication protein A2
• NCBI Official Symbol: RPA2
• NCBI Official Synonym Symbols: REPA2; RPA32; RP-A p32; RP-A p34
• NCBI Protein Information: replication protein A 32 kDa subunit
• UniProt Protein Name: Replication protein A 32 kDa subunit
• Protein Family: Replication protein
• UniProt Gene Name: RPA2
• UniProt Synonym Gene Names: REPA2; RPA32; RPA34; RP-A p32; RF-A protein 2; RP-A p34
• UniProt Entry Name: RFA2_HUMAN

NCBI Description

This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017]

Uniprot Description

RFA2: Required for DNA recombination, repair and replication. The activity of RP-A is mediated by single-stranded DNA binding and protein interactions. Required for the efficient recruitment of the DNA double-strand break repair factor RAD51 to chromatin in response to DNA damage. Heterotrimer of 70, 32 and 14 kDa chains (canonical replication protein A complex). Component of the alternative replication protein A complex (aRPA) composed of RPA1, RPA3 and RPA4. The DNA-binding activity may reside exclusively on the 70 kDa subunit. Binds to SERTAD3/RBT1. Interacts with TIPIN. Directly interacts with PPP4R2, but not with SMEK2; this interaction is DNA damage-dependent and leads RPA2 dephosphorylation by PPP4C recruitment. Interacts with RAD51, preferentially when hyperphosphorylated. Directly interacts with RFWD3. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA replication

Chromosomal Location of Human Ortholog: 1p35

Cellular Component: nucleoplasm; chromosome, telomeric region; PML body; DNA replication factor A complex; nucleus

Molecular Function: protein binding; enzyme binding; ubiquitin protein ligase binding; damaged DNA binding; protein N-terminus binding; protein phosphatase binding; single-stranded DNA binding

Biological Process: G1 DNA damage checkpoint; mismatch repair; DNA strand elongation during DNA replication; DNA repair; double-strand break repair via homologous recombination; telomere maintenance via semi-conservative replication; DNA recombinase assembly; nucleotide-excision repair; base-excision repair; double-strand break repair; transcription-coupled nucleotide-excision repair; telomere maintenance via recombination; nucleotide-excision repair, DNA damage removal; mitotic cell cycle; nucleotide-excision repair, DNA gap filling; DNA replication; telomere maintenance; G1/S transition of mitotic cell cycle