Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCR6 cdna clone

CCR6 cDNA Clone

Gene Names
CCR6; BN-1; DCR2; DRY6; CCR-6; CD196; CKRL3; GPR29; CKR-L3; CMKBR6; GPRCY4; STRL22; CC-CKR-6; C-C CKR-6
Synonyms
CCR6; CCR6 cDNA Clone; CCR6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcggggaatcaatgaatttcagcgatgttttcgactccagtgaagattattttgtgtcagtcaatacttcatattactcagttgattctgagatgttactgtgctccttgcaggaggtcaggcagttctccaggctatttgtaccgattgcctactccttgatctgtgtctttggcctcctggggaatattctggtggtgatcacctttgctttttataagaaggccaggtctatgacagacgtctatctcttgaacatggccattgcagacatcctctttgttcttactctcccattctgggcagtgagtcatgccaccggtgcgtgggttttcagcaatgccacgtgcaagttgctaaaaggcatctatgccatcaactttaactgcgggatgctgctcctgacttgcattagcatggaccggtacatcgccattgtacaggcgactaagtcattccggctccgatccagaacactaccgcgcagcaaaatcatctgccttgttgtgtgggggctgtcagtcatcatctccagctcaacttttgtcttcaaccaaaaatacaacacccaaggcagcgatgtctgtgaacccaagtaccagactgtctcggagcccatcaggtggaagctgctgatgttggggcttgagctactctttggtttctttatccctttgatgttcatgatattttgttacacgttcattgtcaaaaccttggtgcaagctcagaattctaaaaggcacaaagccatccgtgtaatcatagctgtggtgcttgtgtttctggcttgtcagattcctcataacatggtcctgcttgtgacggctgcaaatttgggtaaaatgaaccgatcctgccagagcgaaaagctaattggctatacgaaaactgtcacagaagtcctggctttcctgcactgctgcctgaaccctgtgctctacgcttttattgggcagaagttcagaaactactttctgaagatcttgaaggacctgtggtgtgtgagaaggaagtacaagtcctcaggcttctcctgtgccgggaggtactcagaaaacatttctcggcagaccagtgagaccgcagataacgacaatgcgtcgtccttcactatgtga
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,494 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) receptor 6, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine receptor 6
NCBI Official Symbol
CCR6
NCBI Official Synonym Symbols
BN-1; DCR2; DRY6; CCR-6; CD196; CKRL3; GPR29; CKR-L3; CMKBR6; GPRCY4; STRL22; CC-CKR-6; C-C CKR-6
NCBI Protein Information
C-C chemokine receptor type 6
UniProt Protein Name
C-C chemokine receptor type 6
Protein Family
UniProt Gene Name
CCR6
UniProt Synonym Gene Names
CKRL3; CMKBR6; GPR29; STRL22; C-C CKR-6; CC-CKR-6; CCR-6; CKR-L3; GPRCY4
UniProt Entry Name
CCR6_HUMAN

NCBI Description

This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CCR6: Receptor for a C-C type chemokine. Binds to MIP-3- alpha/LARC and subsequently transduces a signal by increasing the intracellular calcium ions level. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, integral; Motility/polarity/chemotaxis; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 6q27

Cellular Component: cell surface; integral to plasma membrane; plasma membrane

Molecular Function: C-C chemokine binding; C-C chemokine receptor activity; chemokine receptor activity; protein binding; receptor activity

Biological Process: calcium-mediated signaling; cell motility; cellular defense response; chemotaxis; dendritic cell chemotaxis; humoral immune response; immune response; isotype switching to IgA isotypes; leukocyte migration during inflammatory response; signal transduction

Research Articles on CCR6

Similar Products

Product Notes

The CCR6 ccr6 (Catalog #AAA1279005) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgggg aatcaatgaa tttcagcgat gttttcgact ccagtgaaga ttattttgtg tcagtcaata cttcatatta ctcagttgat tctgagatgt tactgtgctc cttgcaggag gtcaggcagt tctccaggct atttgtaccg attgcctact ccttgatctg tgtctttggc ctcctgggga atattctggt ggtgatcacc tttgcttttt ataagaaggc caggtctatg acagacgtct atctcttgaa catggccatt gcagacatcc tctttgttct tactctccca ttctgggcag tgagtcatgc caccggtgcg tgggttttca gcaatgccac gtgcaagttg ctaaaaggca tctatgccat caactttaac tgcgggatgc tgctcctgac ttgcattagc atggaccggt acatcgccat tgtacaggcg actaagtcat tccggctccg atccagaaca ctaccgcgca gcaaaatcat ctgccttgtt gtgtgggggc tgtcagtcat catctccagc tcaacttttg tcttcaacca aaaatacaac acccaaggca gcgatgtctg tgaacccaag taccagactg tctcggagcc catcaggtgg aagctgctga tgttggggct tgagctactc tttggtttct ttatcccttt gatgttcatg atattttgtt acacgttcat tgtcaaaacc ttggtgcaag ctcagaattc taaaaggcac aaagccatcc gtgtaatcat agctgtggtg cttgtgtttc tggcttgtca gattcctcat aacatggtcc tgcttgtgac ggctgcaaat ttgggtaaaa tgaaccgatc ctgccagagc gaaaagctaa ttggctatac gaaaactgtc acagaagtcc tggctttcct gcactgctgc ctgaaccctg tgctctacgc ttttattggg cagaagttca gaaactactt tctgaagatc ttgaaggacc tgtggtgtgt gagaaggaag tacaagtcct caggcttctc ctgtgccggg aggtactcag aaaacatttc tcggcagacc agtgagaccg cagataacga caatgcgtcg tccttcacta tgtga. It is sometimes possible for the material contained within the vial of "CCR6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.