Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFT52 cdna clone

IFT52 cDNA Clone

Gene Names
IFT52; NGD2; NGD5; CGI-53; C20orf9
Synonyms
IFT52; IFT52 cDNA Clone; IFT52 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaagagctgcggagcaccattcttttcaatgcctacaaaaaggagatatttaccaccaacaatggctacaaatccatgcagaaaaaacttcggagtaattggaagattcagagcttaaaagatgaaatcacatctgagaagttaaatggagtaaaactgtggattacagctgggccaagggaaaaatttactgcagctgagtttgaaatcctgaagaaatatcttgacactggtggagatgtctttgtgatgctaggagaaggtggagaatccagatttgacaccaatattaactttttactagaagaatatggaatcatggttaataatgatgctgtggttagaaatgtatatcacaaatatttccatcctaaagaagctctagtttccagtggagtcttgaacagggaaattagccgagctgcaggaaaggctgtgcctgggatcattgatgaggaaagcagtggaaacaatgcccaggctctcacctttgtgtatccttttggtgccacattgagtgtcatgaaaccagcagtggcggttctgtctacaggttctgtctgcttcccacttaacagacccattttggctttctatcactcaaagaaccaaggtgggaagctggcagtgcttggttcatgtcacatgttcagtgatcaatatttggacaaagaagaaaacagcaaaatcatggatgttgttttccagtggctcacgacaggagacatccacctaaaccagattgatgctgaggacccagagatttctgactacatgatgctgccctacacagccaccctatcaaagcggaatcgagagtgtctccaggagagtgatgagatcccaagggactttaccaccctcttcgacctgtccatcttccagctggataccacctccttccacagcgtcatcgaggctcacgagcagctaaatgtgaaacatgaaccactccagctcatccagcctcagtttgagacgccgctgccaacccttcagcctgcggtttttcctcccagtttccgggagttaccacctcctcctctggagctatttgatttagatgaaacgttctcctctgagaaggcacggctggctcagattaccaataagtgtactgaagaagacctggaattttatgtcaggaagtgtggtgatattcttggagtaaccagtaaactaccaaaggaccaacaggatgccaaacatatccttgagcacgtcttcttccaagtggtggagttcaagaaattgaaccaggaacatgacatcgatacaagtgaaacagcattccagaacaatttctga
Sequence Length
1314
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,706 Da
NCBI Official Full Name
Homo sapiens intraflagellar transport 52 homolog (Chlamydomonas), mRNA
NCBI Official Synonym Full Names
intraflagellar transport 52
NCBI Official Symbol
IFT52
NCBI Official Synonym Symbols
NGD2; NGD5; CGI-53; C20orf9
NCBI Protein Information
intraflagellar transport protein 52 homolog
UniProt Protein Name
Intraflagellar transport protein 52 homolog
UniProt Gene Name
IFT52
UniProt Synonym Gene Names
C20orf9; NGD5
UniProt Entry Name
IFT52_HUMAN

Uniprot Description

IFT52: Component of IFT complex B composed of IFT88, IFT57, TRAF3IP1, IFT52, IFT27, HSPB11 and IFT20.

Chromosomal Location of Human Ortholog: -

Molecular Function: protein C-terminus binding

Similar Products

Product Notes

The IFT52 ift52 (Catalog #AAA1278934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaag agctgcggag caccattctt ttcaatgcct acaaaaagga gatatttacc accaacaatg gctacaaatc catgcagaaa aaacttcgga gtaattggaa gattcagagc ttaaaagatg aaatcacatc tgagaagtta aatggagtaa aactgtggat tacagctggg ccaagggaaa aatttactgc agctgagttt gaaatcctga agaaatatct tgacactggt ggagatgtct ttgtgatgct aggagaaggt ggagaatcca gatttgacac caatattaac tttttactag aagaatatgg aatcatggtt aataatgatg ctgtggttag aaatgtatat cacaaatatt tccatcctaa agaagctcta gtttccagtg gagtcttgaa cagggaaatt agccgagctg caggaaaggc tgtgcctggg atcattgatg aggaaagcag tggaaacaat gcccaggctc tcacctttgt gtatcctttt ggtgccacat tgagtgtcat gaaaccagca gtggcggttc tgtctacagg ttctgtctgc ttcccactta acagacccat tttggctttc tatcactcaa agaaccaagg tgggaagctg gcagtgcttg gttcatgtca catgttcagt gatcaatatt tggacaaaga agaaaacagc aaaatcatgg atgttgtttt ccagtggctc acgacaggag acatccacct aaaccagatt gatgctgagg acccagagat ttctgactac atgatgctgc cctacacagc caccctatca aagcggaatc gagagtgtct ccaggagagt gatgagatcc caagggactt taccaccctc ttcgacctgt ccatcttcca gctggatacc acctccttcc acagcgtcat cgaggctcac gagcagctaa atgtgaaaca tgaaccactc cagctcatcc agcctcagtt tgagacgccg ctgccaaccc ttcagcctgc ggtttttcct cccagtttcc gggagttacc acctcctcct ctggagctat ttgatttaga tgaaacgttc tcctctgaga aggcacggct ggctcagatt accaataagt gtactgaaga agacctggaa ttttatgtca ggaagtgtgg tgatattctt ggagtaacca gtaaactacc aaaggaccaa caggatgcca aacatatcct tgagcacgtc ttcttccaag tggtggagtt caagaaattg aaccaggaac atgacatcga tacaagtgaa acagcattcc agaacaattt ctga. It is sometimes possible for the material contained within the vial of "IFT52, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.