SH3RF2 cdna clone
SH3RF2 cDNA Clone
Gene Names
SH3RF2; HEPP1; POSHER; RNF158; PPP1R39
Synonyms
SH3RF2; SH3RF2 cDNA Clone; SH3RF2 cdna clone
Sequence
atgagaaagagtaagtggtggcagagagatggatccctgcagagacccctccagtccgggatccccactctcgtggtaggctccctcagacgcagccccaccatggtccttcggcctcagcagttccaattctaccagccacaggggatcccctcctccccctcagccgtggtggtggagatggggtccaagcctgccctcacgggggagcccgccctcacgtgcatcagcaggggcagtgaggcccggatccactccgcggccagctccctcattatggaagacaaagaaatccccatcaagagtgagcctctgccaaaaccgcccgcatctgccccaccatccatcctggtgaaaccagaaaactcaagaaatggcatcgaaaagcaagtcaaaaccgtgagatttcagaattacagccctcctcccaccaaacattacacctcccatcccacctccggaaagcctgaacagccagccaccctcaaggcgtcccagcctgaagcagcgtccttgggcccagagatgaccgtcctatttgcccaccgaagtggctgccactccggacagcagacagacctccggagaaagtcagctcttgccaaggccacaaccctggtgtccactgcctcaggcacgcagaccgtgtttcccagcaaatga
Sequence Length
663
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,895 Da
NCBI Official Full Name
Homo sapiens SH3 domain containing ring finger 2, mRNA
NCBI Official Synonym Full Names
SH3 domain containing ring finger 2
NCBI Official Symbol
SH3RF2
NCBI Official Synonym Symbols
HEPP1; POSHER; RNF158; PPP1R39
NCBI Protein Information
putative E3 ubiquitin-protein ligase SH3RF2
UniProt Protein Name
Putative E3 ubiquitin-protein ligase SH3RF2
Protein Family
UniProt Gene Name
SH3RF2
UniProt Synonym Gene Names
PPP1R39; RNF158; HEPP1
UniProt Entry Name
SH3R2_HUMAN
Uniprot Description
SH3RF2: Inhibits PPP1CA phosphatase activity. May be a E3 ubiquitin-protein ligase (Potential). May play a role in cardiac function. Belongs to the SH3RF family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin ligase; Ligase; EC 6.3.2.-; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 5q32
Cellular Component: nucleoplasm
Molecular Function: phosphatase binding; protein binding; protein phosphatase 1 binding
Research Articles on SH3RF2
Similar Products
Product Notes
The SH3RF2 sh3rf2 (Catalog #AAA1278899) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaaaga gtaagtggtg gcagagagat ggatccctgc agagacccct ccagtccggg atccccactc tcgtggtagg ctccctcaga cgcagcccca ccatggtcct tcggcctcag cagttccaat tctaccagcc acaggggatc ccctcctccc cctcagccgt ggtggtggag atggggtcca agcctgccct cacgggggag cccgccctca cgtgcatcag caggggcagt gaggcccgga tccactccgc ggccagctcc ctcattatgg aagacaaaga aatccccatc aagagtgagc ctctgccaaa accgcccgca tctgccccac catccatcct ggtgaaacca gaaaactcaa gaaatggcat cgaaaagcaa gtcaaaaccg tgagatttca gaattacagc cctcctccca ccaaacatta cacctcccat cccacctccg gaaagcctga acagccagcc accctcaagg cgtcccagcc tgaagcagcg tccttgggcc cagagatgac cgtcctattt gcccaccgaa gtggctgcca ctccggacag cagacagacc tccggagaaa gtcagctctt gccaaggcca caaccctggt gtccactgcc tcaggcacgc agaccgtgtt tcccagcaaa tga. It is sometimes possible for the material contained within the vial of "SH3RF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
