Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRYZL1 cdna clone

CRYZL1 cDNA Clone

Gene Names
CRYZL1; 4P11; QOH-1
Synonyms
CRYZL1; CRYZL1 cDNA Clone; CRYZL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaggcttatatttccaacagagttccacagatgaagaaataacatttgtatttcaagaaaaggaagatcttcctgttacagaggataactttgtgaaacttcaagttaaagcttgtgctctgagccagataaatacaaagcttctggcagaaatgaagatgaaaaaggatttatttcctgttgggagagaaattgctggaattgtattagatgttggaagcaaggtatcattctttcaaccagatgatgaagtagttgaagtactttcccggctgggtgctgtggctcacgtctgtaatcccagcacgttgggaggccaaggtgggcgaatcacctga
Sequence Length
342
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,928 Da
NCBI Official Full Name
Homo sapiens crystallin, zeta (quinone reductase)-like 1, mRNA
NCBI Official Synonym Full Names
crystallin zeta like 1
NCBI Official Symbol
CRYZL1
NCBI Official Synonym Symbols
4P11; QOH-1
NCBI Protein Information
quinone oxidoreductase-like protein 1
UniProt Protein Name
Quinone oxidoreductase-like protein 1
UniProt Gene Name
CRYZL1
UniProt Synonym Gene Names
4P11; QOH-1
UniProt Entry Name
QORL1_HUMAN

NCBI Description

This gene encodes a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]

Uniprot Description

CRYZL1: a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]

Protein type: Oxidoreductase; EC 1.-.-.-

Chromosomal Location of Human Ortholog: 21q21.3

Cellular Component: cytosol

Research Articles on CRYZL1

Similar Products

Product Notes

The CRYZL1 cryzl1 (Catalog #AAA1278878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaggct tatatttcca acagagttcc acagatgaag aaataacatt tgtatttcaa gaaaaggaag atcttcctgt tacagaggat aactttgtga aacttcaagt taaagcttgt gctctgagcc agataaatac aaagcttctg gcagaaatga agatgaaaaa ggatttattt cctgttggga gagaaattgc tggaattgta ttagatgttg gaagcaaggt atcattcttt caaccagatg atgaagtagt tgaagtactt tcccggctgg gtgctgtggc tcacgtctgt aatcccagca cgttgggagg ccaaggtggg cgaatcacct ga. It is sometimes possible for the material contained within the vial of "CRYZL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.