WDR62 cdna clone
WDR62 cDNA Clone
Gene Names
WDR62; MCPH2; C19orf14
Synonyms
WDR62; WDR62 cDNA Clone; WDR62 cdna clone
Sequence
atgaagcccgagagtctggagaactccattctggattcactggagccacagagcctggccagcctgctgagtgagtcagagagtccccaggaagctggccgcgggcacccctccttcctgccccagcagaaggaatcatctgaggccagtgagctcatcctctactctctggaggcagaagtgacagtcacagggacagacagccagtattgcaggaaggaggtggaggccgggcctggagaccagcagggcgactcctacctcagggtgtcctccgacagcccaaaggaccagagcccgcctgaggactcgggggagtcagaggccgacctggagtgcagcttcgcagccatccactccccagctccgcctcctgaccctgcccctcggtttgccacgtcgctgccccatttcccaggatgcgcaggtcccacagaagatgagctgtccctgcccgagggacccagcgtccccagcagctccctaccccagactccggagcaggagaagttcctccgccaccactttgagacactgactgagtccccctgcagagctctgggagacgtggaggcctctgaagctgaagaccacttcttcaacccacgcctgagtatctccacgcagttcctctcaagcctccagaaggcatccaggttcacccataccttccctccccgggcaacccagtgccttgtgaagtctccagaggtcaagctcatggaccgaggcggaagccagcccagagcaggtactggctacgcctccccagacaggacccacgtccttgctgcagggaaggctgaagagaccctggaggcctggcgcccaccacctccctgccttacgagcctggcgtcctgtgtccctgcttcctccgtgctgcccacagacaggaatctcccaacgcccacatctgcacccaccccaggcctggctcagggtgtccatgccccctccacctgttcctacatggaggccactgccagctcccgtgccaggatatcacgcagcatctccctcggtgacagtgagggccctatcgtggccacactggcccagcccctccgtaggccatcgtccgttggggagctggcctccttgggccaggagcttcaggccatcaccaccgcgacaacacccagtttggacagtgagggccaagagcctgccctgcgttcctggggcaaccacgaggcccgggccaacctgagactgaccctgtcaagtgcctgtgatgggctcctgctgccccccgtggatacccagcctggcgtcaccgtccctgcagtgagcttcccagcccctagccctgtggaagagagcgccctgaggctccacggctctgcctttcgcccaagtctcccagctcctgagtcccctggccttcctgcccaccccagtaacccccagcttccagaggcccggcctggcatccctggcagcactgcctccctcctggagcccacctccggtgcacttggtctgttccagggcagccctgcccgctggagtgagccctgggtgccggttgaagccctgcccccatctccccttgagctgagcagggtggggaacatcttgcacaggctgcagaccaccttccaagaagccctcgacctttaccgtgtgttggtctccagtggccaggtggacaccgggcagcagcaggcacggactgagctggtctccaccttcctgtggatccacagccagctggaggctgaatgcctggtggggactagtgtggccccagcccaggctctgcccagcccaggacccccgtccccaccgacgctgtaccccctggccagcccagacctgcaggccctgctggaacactactcggagctgctggtgcaggccgtgcggaggaaggcacgggggcactga
Sequence Length
1893
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
166,511 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 62, mRNA
NCBI Official Synonym Full Names
WD repeat domain 62
NCBI Official Symbol
WDR62
NCBI Official Synonym Symbols
MCPH2; C19orf14
NCBI Protein Information
WD repeat-containing protein 62
UniProt Protein Name
WD repeat-containing protein 62
Protein Family
UniProt Gene Name
WDR62
UniProt Synonym Gene Names
C19orf14
UniProt Entry Name
WDR62_HUMAN
NCBI Description
This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
Uniprot Description
WDR62: a WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 19q13.12
Cellular Component: centrosome; nucleus; spindle pole
Molecular Function: protein binding
Biological Process: centriole replication; cerebral cortex development; mitotic spindle organization and biogenesis; neurogenesis
Disease: Microcephaly 2, Primary, Autosomal Recessive, With Or Without Cortical Malformations
Research Articles on WDR62
Similar Products
Product Notes
The WDR62 wdr62 (Catalog #AAA1278452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcccg agagtctgga gaactccatt ctggattcac tggagccaca gagcctggcc agcctgctga gtgagtcaga gagtccccag gaagctggcc gcgggcaccc ctccttcctg ccccagcaga aggaatcatc tgaggccagt gagctcatcc tctactctct ggaggcagaa gtgacagtca cagggacaga cagccagtat tgcaggaagg aggtggaggc cgggcctgga gaccagcagg gcgactccta cctcagggtg tcctccgaca gcccaaagga ccagagcccg cctgaggact cgggggagtc agaggccgac ctggagtgca gcttcgcagc catccactcc ccagctccgc ctcctgaccc tgcccctcgg tttgccacgt cgctgcccca tttcccagga tgcgcaggtc ccacagaaga tgagctgtcc ctgcccgagg gacccagcgt ccccagcagc tccctacccc agactccgga gcaggagaag ttcctccgcc accactttga gacactgact gagtccccct gcagagctct gggagacgtg gaggcctctg aagctgaaga ccacttcttc aacccacgcc tgagtatctc cacgcagttc ctctcaagcc tccagaaggc atccaggttc acccatacct tccctccccg ggcaacccag tgccttgtga agtctccaga ggtcaagctc atggaccgag gcggaagcca gcccagagca ggtactggct acgcctcccc agacaggacc cacgtccttg ctgcagggaa ggctgaagag accctggagg cctggcgccc accacctccc tgccttacga gcctggcgtc ctgtgtccct gcttcctccg tgctgcccac agacaggaat ctcccaacgc ccacatctgc acccacccca ggcctggctc agggtgtcca tgccccctcc acctgttcct acatggaggc cactgccagc tcccgtgcca ggatatcacg cagcatctcc ctcggtgaca gtgagggccc tatcgtggcc acactggccc agcccctccg taggccatcg tccgttgggg agctggcctc cttgggccag gagcttcagg ccatcaccac cgcgacaaca cccagtttgg acagtgaggg ccaagagcct gccctgcgtt cctggggcaa ccacgaggcc cgggccaacc tgagactgac cctgtcaagt gcctgtgatg ggctcctgct gccccccgtg gatacccagc ctggcgtcac cgtccctgca gtgagcttcc cagcccctag ccctgtggaa gagagcgccc tgaggctcca cggctctgcc tttcgcccaa gtctcccagc tcctgagtcc cctggccttc ctgcccaccc cagtaacccc cagcttccag aggcccggcc tggcatccct ggcagcactg cctccctcct ggagcccacc tccggtgcac ttggtctgtt ccagggcagc cctgcccgct ggagtgagcc ctgggtgccg gttgaagccc tgcccccatc tccccttgag ctgagcaggg tggggaacat cttgcacagg ctgcagacca ccttccaaga agccctcgac ctttaccgtg tgttggtctc cagtggccag gtggacaccg ggcagcagca ggcacggact gagctggtct ccaccttcct gtggatccac agccagctgg aggctgaatg cctggtgggg actagtgtgg ccccagccca ggctctgccc agcccaggac ccccgtcccc accgacgctg taccccctgg ccagcccaga cctgcaggcc ctgctggaac actactcgga gctgctggtg caggccgtgc ggaggaaggc acgggggcac tga. It is sometimes possible for the material contained within the vial of "WDR62, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
