Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RFK cdna clone

RFK cDNA Clone

Gene Names
RFK; RIFK
Synonyms
RFK; RFK cDNA Clone; RFK cdna clone
Ordering
For Research Use Only!
Sequence
atgccccgagcggactgcattatgaggcacctgccttacttctgccggggtcaagtggtgcggggcttcggccgcggctccaagcagctgggcatccccacagctaattttcctgagcaagtggtagataatcttccagctgatatatccactggtatttactatggttgggccagtgttggaagtggagatgtccataagatggtggtgagcataggatggaacccatattacaagaatacgaagaagtctatggaaacacatatcatgcataccttcaaagaggacttctatggggaaatcctcaatgtcgccattgttggctacctgagaccagaaaagaactttgattctttagagtcacttatttcagcaattcaaggtgatattgaagaagctaagaaacgactagagttaccagaacatttgaaaatcaaagaagacaatttcttccaggtttctaaaagcaaaataatgaatggccactga
Sequence Length
489
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,623 Da
NCBI Official Full Name
Homo sapiens riboflavin kinase, mRNA
NCBI Official Synonym Full Names
riboflavin kinase
NCBI Official Symbol
RFK
NCBI Official Synonym Symbols
RIFK
NCBI Protein Information
riboflavin kinase
UniProt Protein Name
Riboflavin kinase
UniProt Gene Name
RFK
UniProt Entry Name
RIFK_HUMAN

NCBI Description

Riboflavin kinase (RFK; EC 2.7.1.26) is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis (Karthikeyan et al., 2003 [PubMed 12623014]).[supplied by OMIM, Nov 2009]

Uniprot Description

RFK: Catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin-mononucleotide (FMN).

Protein type: Cofactor and Vitamin Metabolism - riboflavin; EC 2.7.1.26; Kinase, other

Chromosomal Location of Human Ortholog: 9q21.13

Cellular Component: cytosol

Molecular Function: riboflavin kinase activity

Biological Process: apoptosis; positive regulation of NAD(P)H oxidase activity; riboflavin metabolic process

Research Articles on RFK

Similar Products

Product Notes

The RFK rfk (Catalog #AAA1278447) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccgag cggactgcat tatgaggcac ctgccttact tctgccgggg tcaagtggtg cggggcttcg gccgcggctc caagcagctg ggcatcccca cagctaattt tcctgagcaa gtggtagata atcttccagc tgatatatcc actggtattt actatggttg ggccagtgtt ggaagtggag atgtccataa gatggtggtg agcataggat ggaacccata ttacaagaat acgaagaagt ctatggaaac acatatcatg cataccttca aagaggactt ctatggggaa atcctcaatg tcgccattgt tggctacctg agaccagaaa agaactttga ttctttagag tcacttattt cagcaattca aggtgatatt gaagaagcta agaaacgact agagttacca gaacatttga aaatcaaaga agacaatttc ttccaggttt ctaaaagcaa aataatgaat ggccactga. It is sometimes possible for the material contained within the vial of "RFK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.