Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MIER1 cdna clone

MIER1 cDNA Clone

Gene Names
MIER1; ER1; MI-ER1
Synonyms
MIER1; MIER1 cDNA Clone; MIER1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggaaggagaaacaaacttcagctctgaaatagaagatcttgcaagggaaggcgacatgccaattcatgaacttctcagcctttatggttatggtagtactgttcgactacctgaagaagatgaggaagaggaagaagaggaagaagaaggtgaagatgatgaagatgctgataatgatgacaacagtggctgtagtggggaaaataaagaggagaatataaaggattcatcaggtcaggaggatgaaactcagtcttccaatgatgatccatcacaatctgttgcttctcaagatgcccaggaaataatccgcccacgtcgatgtaaatattttgatacaaatagtgaagtagaagaagaatctgaagaagatgaagattatattccatcagaagactggaaaaaggagattatggtgggctccatgtttcaagcagaaattccagttggcatttgtagatactaa
Sequence Length
471
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,357 Da
NCBI Official Full Name
Homo sapiens mesoderm induction early response 1 homolog (Xenopus laevis), mRNA
NCBI Official Synonym Full Names
MIER1 transcriptional regulator
NCBI Official Symbol
MIER1
NCBI Official Synonym Symbols
ER1; MI-ER1
NCBI Protein Information
mesoderm induction early response protein 1
UniProt Protein Name
Mesoderm induction early response protein 1
UniProt Gene Name
MIER1
UniProt Synonym Gene Names
KIAA1610; Early response 1; Er1; Mi-er1; hMi-er1
UniProt Entry Name
MIER1_HUMAN

NCBI Description

This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]

Uniprot Description

MIER1: a transcriptional repressor which acts through recruitment of HDAC1. Contains a Myb-like DNA-binding and ELM2 domain. Its expression is associated with breast carcinoma

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: nucleoplasm; transcriptional repressor complex

Molecular Function: protein binding; signal transducer activity

Biological Process: positive regulation of chromatin silencing; positive regulation of I-kappaB kinase/NF-kappaB cascade

Research Articles on MIER1

Similar Products

Product Notes

The MIER1 mier1 (Catalog #AAA1278058) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggaag gagaaacaaa cttcagctct gaaatagaag atcttgcaag ggaaggcgac atgccaattc atgaacttct cagcctttat ggttatggta gtactgttcg actacctgaa gaagatgagg aagaggaaga agaggaagaa gaaggtgaag atgatgaaga tgctgataat gatgacaaca gtggctgtag tggggaaaat aaagaggaga atataaagga ttcatcaggt caggaggatg aaactcagtc ttccaatgat gatccatcac aatctgttgc ttctcaagat gcccaggaaa taatccgccc acgtcgatgt aaatattttg atacaaatag tgaagtagaa gaagaatctg aagaagatga agattatatt ccatcagaag actggaaaaa ggagattatg gtgggctcca tgtttcaagc agaaattcca gttggcattt gtagatacta a. It is sometimes possible for the material contained within the vial of "MIER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.