Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PYHIN1 cdna clone

PYHIN1 cDNA Clone

Gene Names
PYHIN1; IFIX
Synonyms
PYHIN1; PYHIN1 cDNA Clone; PYHIN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaataactacaagaaaattgttctactgaaaggattagaggtcatcaatgattatcattttagaattgttaagtccttactgagtaacgatttaaaacttaatccaaaaatgaaagaagagtatgacaaaattcagattgctgacttgatggaggaaaagttcccaggtgatgccggtttgggcaaactaatagaattcttcaaagaaataccaacactgggagaccttgctgaaactcttaaaagagaaaagttaaaagttgcaaataaaattgaatccattccagtcaaaggaataatcccatctaaaaagacgaaacagaaagaagtgtatcctgctacacctgcatgcaccccaagcaaccgtctcacagctaaaggagcagaggagactcttggacctcagaaaagaaaaaaaccatctgaagaagagactggaaccaaaaggagtaagatgtccaaagagcagactcggccttcctgctctgcaggagccagcacgtccacagccatgggccgttccccacctccccagacctcatcatcagctccacccaacacttcctcaactgaggcatatttgatgaacttgacattatctctgactgcaggaagttttctgtcctgtgctgtttggggaagagacagagaactgcggaatctggaactttcagcaacagactcactgtctactgcccccatctattatacacccattccctttgctcactaa
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,999 Da
NCBI Official Full Name
Homo sapiens pyrin and HIN domain family, member 1, mRNA
NCBI Official Synonym Full Names
pyrin and HIN domain family member 1
NCBI Official Symbol
PYHIN1
NCBI Official Synonym Symbols
IFIX
NCBI Protein Information
pyrin and HIN domain-containing protein 1
UniProt Protein Name
Pyrin and HIN domain-containing protein 1
UniProt Gene Name
PYHIN1
UniProt Synonym Gene Names
IFIX
UniProt Entry Name
IFIX_HUMAN

NCBI Description

The protein encoded by this gene belongs to the HIN-200 family of interferon-inducible proteins that share a 200-amino acid signature motif at their C-termini. HIN200 proteins are primarily nuclear and are involved in transcriptional regulation of genes important for cell cycle control, differentiation, and apoptosis. Downregulation of this gene is associated with breast cancer. This protein acts as a tumor suppressor by promoting ubiquitination and subsequent degradation of MDM2, which leads to stabilization of p53/TP53. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

PYHIN1: Major mediator of the tumor suppressor activity of IFN in breast cancer cells. Promotes ubiquitination and subsequent degradation of MDM2, which leads to p53/TP53 stabilization. Promotes ubiquitination and subsequent degradation of HDAC1, which in turn enhances maspin expression, and impairs invasive activity of cancer cells. Belongs to the HIN-200 family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor

Chromosomal Location of Human Ortholog: 1q23.1

Research Articles on PYHIN1

Similar Products

Product Notes

The PYHIN1 pyhin1 (Catalog #AAA1278024) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaata actacaagaa aattgttcta ctgaaaggat tagaggtcat caatgattat cattttagaa ttgttaagtc cttactgagt aacgatttaa aacttaatcc aaaaatgaaa gaagagtatg acaaaattca gattgctgac ttgatggagg aaaagttccc aggtgatgcc ggtttgggca aactaataga attcttcaaa gaaataccaa cactgggaga ccttgctgaa actcttaaaa gagaaaagtt aaaagttgca aataaaattg aatccattcc agtcaaagga ataatcccat ctaaaaagac gaaacagaaa gaagtgtatc ctgctacacc tgcatgcacc ccaagcaacc gtctcacagc taaaggagca gaggagactc ttggacctca gaaaagaaaa aaaccatctg aagaagagac tggaaccaaa aggagtaaga tgtccaaaga gcagactcgg ccttcctgct ctgcaggagc cagcacgtcc acagccatgg gccgttcccc acctccccag acctcatcat cagctccacc caacacttcc tcaactgagg catatttgat gaacttgaca ttatctctga ctgcaggaag ttttctgtcc tgtgctgttt ggggaagaga cagagaactg cggaatctgg aactttcagc aacagactca ctgtctactg cccccatcta ttatacaccc attccctttg ctcactaa. It is sometimes possible for the material contained within the vial of "PYHIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.