Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC1 cdna clone

XRCC1 cDNA Clone

Gene Names
XRCC1; RCC
Synonyms
XRCC1; XRCC1 cDNA Clone; XRCC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggagatccgcctccgccatgtcgtgtcctgcagcagccaggactcgactcactgtgcagaaaatcttctcaaggcagacacttaccgaaaatggcgggcagccaaggcaggcgagaagaccatctctgtggtcctacagttggagaaggaggagcagatacacagtgtggacattgggaatgatggctcagctttcgtggaggtgctggtgggcagttcagctggaggcgctggggagcaagactatgaggtccttctggtcacctcatctttcatgtccccttccgagagccgcagtggctcaaaccccaaccgcgttcgcatgtttgggcctgacaagctggtccgggcagccgccgagaagcgctgggaccgggtcaaaattgtttgcagccagccctacagcaaggactccccctttggcttgagttttgtacggtttcatagccccccagacaaagatgaggcagaggccccgtcccagaaggtgacagtgaccaagcttggccagttccgtgtgaaggaggaggatgagagcgccaactctctgaggccgggggctctcttcttcagccggatcaacaagacatccccagtcacagccagcgacccagcaggacctagctatgcagctgctaccctccaggcttctagtgctgcctcctcagcctctccagtctccagggccataggcagcacctccaagccccaggagtctcccaaagggaagaggaagttggatttgaaccaagaagaaaagaagacccccagcaaaccaccagcccagctgtcgccatctgttcccaagagacctaaattgccagctccaactcgtaccccagccacagccccagtccctgcccgagcacagggggcagtgacaggcaaaccccgaggagaaggcaccgagcccagacgaccccgagctggcccagaggagctggggaagatccttcagggtgtggtagtggtgctgagtggcttccagaaccccttccgctccgagctgcgagataaggccctagagcttggggccaagtatcggccagactggacccgggacagcacgcacctcatctgtgcctttgccaacacccccaagtacagccaggtcctaggcctgggaggccgcatcgtgcgtaaggagtgggtgctggactgtcaccgcatgcgtcggcggctgccctcccagaggtacctcatggcagggccaggttccagcagtgaggaggatgaggcctctcacagcggtggcagcggagatgaagcccccaagcttcctcagaagcaaccccagaccaaaaccaagcccactcaggcagctggacccagctcaccccagaagcccccaacccctgaagagaccaaagcagcctcaccagtgctccaggaagatatagacattgagggggtacagtcagaaggacaggacaatggggcggaagattctggggacacagaggatgagctgaggagggtggcagagcagaaggaacacagactgccccctggccaggaggagaatggggaagacccgtatgcaggctccacggatgagaacacggacagtgaggaacaccaggagcctcctgatctgccagtccctgagctcccagatttcttccagggcaagcacttctttctttacggggagttccctggggacgagcggcggaaactcatccgatacgtcacagccttcaatggggagctcgaggactatatgagtgaccgggttcagtttgtgatcacagcacaggaatgggatcccagctttgaggaggccctgatggacaacccctccctggcattcgttcgtccccgatggatctacagttgcaatgagaagcagaagttacttcctcaccagctctatggggtggtgccgcaggcctga
Sequence Length
1902
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,477 Da
NCBI Official Full Name
Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 1, mRNA
NCBI Official Synonym Full Names
X-ray repair cross complementing 1
NCBI Official Symbol
XRCC1
NCBI Official Synonym Symbols
RCC
NCBI Protein Information
DNA repair protein XRCC1
UniProt Protein Name
DNA repair protein XRCC1
Protein Family
UniProt Gene Name
XRCC1
UniProt Entry Name
XRCC1_HUMAN

NCBI Description

The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]

Uniprot Description

XRCC1: Corrects defective DNA strand-break repair and sister chromatid exchange following treatment with ionizing radiation and alkylating agents. Homodimer. Interacts with polynucleotide kinase (PNK), DNA polymerase-beta (POLB) and DNA ligase III (LIG3). Interacts with APTX and APLF. Interacts with APEX1; the interaction is induced by SIRT1 and increases with the acetylated form of APEX1.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA ligase activity; enzyme binding; protein binding

Biological Process: base-excision repair; base-excision repair, DNA ligation; double-strand break repair via homologous recombination; nucleotide-excision repair, DNA gap filling; transcription-coupled nucleotide-excision repair

Research Articles on XRCC1

Similar Products

Product Notes

The XRCC1 xrcc1 (Catalog #AAA1278012) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggaga tccgcctccg ccatgtcgtg tcctgcagca gccaggactc gactcactgt gcagaaaatc ttctcaaggc agacacttac cgaaaatggc gggcagccaa ggcaggcgag aagaccatct ctgtggtcct acagttggag aaggaggagc agatacacag tgtggacatt gggaatgatg gctcagcttt cgtggaggtg ctggtgggca gttcagctgg aggcgctggg gagcaagact atgaggtcct tctggtcacc tcatctttca tgtccccttc cgagagccgc agtggctcaa accccaaccg cgttcgcatg tttgggcctg acaagctggt ccgggcagcc gccgagaagc gctgggaccg ggtcaaaatt gtttgcagcc agccctacag caaggactcc ccctttggct tgagttttgt acggtttcat agccccccag acaaagatga ggcagaggcc ccgtcccaga aggtgacagt gaccaagctt ggccagttcc gtgtgaagga ggaggatgag agcgccaact ctctgaggcc gggggctctc ttcttcagcc ggatcaacaa gacatcccca gtcacagcca gcgacccagc aggacctagc tatgcagctg ctaccctcca ggcttctagt gctgcctcct cagcctctcc agtctccagg gccataggca gcacctccaa gccccaggag tctcccaaag ggaagaggaa gttggatttg aaccaagaag aaaagaagac ccccagcaaa ccaccagccc agctgtcgcc atctgttccc aagagaccta aattgccagc tccaactcgt accccagcca cagccccagt ccctgcccga gcacaggggg cagtgacagg caaaccccga ggagaaggca ccgagcccag acgaccccga gctggcccag aggagctggg gaagatcctt cagggtgtgg tagtggtgct gagtggcttc cagaacccct tccgctccga gctgcgagat aaggccctag agcttggggc caagtatcgg ccagactgga cccgggacag cacgcacctc atctgtgcct ttgccaacac ccccaagtac agccaggtcc taggcctggg aggccgcatc gtgcgtaagg agtgggtgct ggactgtcac cgcatgcgtc ggcggctgcc ctcccagagg tacctcatgg cagggccagg ttccagcagt gaggaggatg aggcctctca cagcggtggc agcggagatg aagcccccaa gcttcctcag aagcaacccc agaccaaaac caagcccact caggcagctg gacccagctc accccagaag cccccaaccc ctgaagagac caaagcagcc tcaccagtgc tccaggaaga tatagacatt gagggggtac agtcagaagg acaggacaat ggggcggaag attctgggga cacagaggat gagctgagga gggtggcaga gcagaaggaa cacagactgc cccctggcca ggaggagaat ggggaagacc cgtatgcagg ctccacggat gagaacacgg acagtgagga acaccaggag cctcctgatc tgccagtccc tgagctccca gatttcttcc agggcaagca cttctttctt tacggggagt tccctgggga cgagcggcgg aaactcatcc gatacgtcac agccttcaat ggggagctcg aggactatat gagtgaccgg gttcagtttg tgatcacagc acaggaatgg gatcccagct ttgaggaggc cctgatggac aacccctccc tggcattcgt tcgtccccga tggatctaca gttgcaatga gaagcagaag ttacttcctc accagctcta tggggtggtg ccgcaggcct ga. It is sometimes possible for the material contained within the vial of "XRCC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.