Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2M cdna clone

UBE2M cDNA Clone

Gene Names
UBE2M; UBC12; hUbc12; UBC-RS2
Synonyms
UBE2M; UBE2M cDNA Clone; UBE2M cdna clone
Ordering
For Research Use Only!
Sequence
atgatcaagctgttctcgctgaagcagcagaagaaggaggaggagtcggcgggcggcaccaagggcagcagcaagaaggcgtcggcggcgcagctgcggatccagaaggacataaacgagctgaacctgcccaagacgtgtgatatcagcttctcagatccagacgacctcctcaacttcaagctggtcatctgtcctgatgagggcttctacaagagtgggaagtttgtgttcagttttaaggtgggccagggttacccgcatgatccccccaaggtgaagtgtgagacaatggtctatcaccccaacattgacctcgagggcaacgtctgcctcaacatcctcagagaggactggaagccagtccttacgataaactccataatttatggcctgcagtatctcttcttggagcccaaccccgaggacccactgaacaaggaggccgcagaggtcctgcagaacaaccggcggctgtttgagcagaacgtgcagcgctccatgcggggtggctacatcggctccacctactttgagcgctgcctgaaatag
Sequence Length
552
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,900 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 M
NCBI Official Symbol
UBE2M
NCBI Official Synonym Symbols
UBC12; hUbc12; UBC-RS2
NCBI Protein Information
NEDD8-conjugating enzyme Ubc12
UniProt Protein Name
NEDD8-conjugating enzyme Ubc12
UniProt Gene Name
UBE2M
UniProt Synonym Gene Names
UBC12
UniProt Entry Name
UBC12_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin. [provided by RefSeq, Jul 2008]

Uniprot Description

UBE2M: Accepts the ubiquitin-like protein NEDD8 from the UBA3- NAE1 E1 complex and catalyzes its covalent attachment to other proteins. The specific interaction with the E3 ubiquitin ligase RBX1, but not RBX2, suggests that the RBX1-UBE2M complex neddylates specific target proteins, such as CUL1, CUL2, CUL3 and CUL4. Involved in cell proliferation. Interacts with UBA3, DCUN1D1 and RBX1. Belongs to the ubiquitin-conjugating enzyme family. UBC12 subfamily.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ligase; EC 6.3.2.-; Ubiquitin conjugating system; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19q13.43

Cellular Component: cytoplasm; cytosol

Molecular Function: NEDD8 ligase activity; protein binding; ribosomal S6-glutamic acid ligase activity; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: protein modification process; protein neddylation; transforming growth factor beta receptor signaling pathway

Research Articles on UBE2M

Similar Products

Product Notes

The UBE2M ube2m (Catalog #AAA1277978) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcaagc tgttctcgct gaagcagcag aagaaggagg aggagtcggc gggcggcacc aagggcagca gcaagaaggc gtcggcggcg cagctgcgga tccagaagga cataaacgag ctgaacctgc ccaagacgtg tgatatcagc ttctcagatc cagacgacct cctcaacttc aagctggtca tctgtcctga tgagggcttc tacaagagtg ggaagtttgt gttcagtttt aaggtgggcc agggttaccc gcatgatccc cccaaggtga agtgtgagac aatggtctat caccccaaca ttgacctcga gggcaacgtc tgcctcaaca tcctcagaga ggactggaag ccagtcctta cgataaactc cataatttat ggcctgcagt atctcttctt ggagcccaac cccgaggacc cactgaacaa ggaggccgca gaggtcctgc agaacaaccg gcggctgttt gagcagaacg tgcagcgctc catgcggggt ggctacatcg gctccaccta ctttgagcgc tgcctgaaat ag. It is sometimes possible for the material contained within the vial of "UBE2M, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.