WDR89 cdna clone
WDR89 cDNA Clone
Gene Names
WDR89; MSTP050; C14orf150
Synonyms
WDR89; WDR89 cDNA Clone; WDR89 cdna clone
Sequence
atggaaaagattgaggaacaatttgctaatctgcacattgttaaatgttccttaggaaccaaagagcccacttaccttcttggtatagacacatcaaagactgtccaagcaggaaaggaaaacttggttgctgttttatgttctaatggatcaatcagaatatatgataaagaaaggttaaatgtactacgagaatttagtggatatcctggacttcttaatggagtcagatttgcaaattcctgtgacagtgtatattcagcatgtactgatggcactgtgaaatgctgggatgctcgagtagccagagaaaaacctgttcagctcttcaagggttacccttccaatatttttatcagttttgatattaattgtaatgatcatattatttgtgctggtacagaaaaagttgatgatgatgcattgttggtgttttgggatgcaaggatgaattctcagaatttatctacaactaaagactcacttggtgcatattcagagacacatagtgatgatgtcactcaagtacgtttccatcccagcaatcccaacatggtagtctcaggttcatctgatggcctggtaaatgtatttgatattaatattgataatgaggaggatgcactggttacaacctgtaactcaatttcatcagtaagctgtattggttggtctgggaaaggttataaacagatttactgcatgacacatgatgaaggattttattggtgggatcttaatcatctggacactgatgaaccagttacacgtttgaacatccaggatgtcagagaagtagttaacatgaaagaagatgctttggactatttgattggtggcctatatcatgaaaagacagacacattgcatgttattggaggaacaaacaaaggaaggattcatttgatgaactgcagcatgtcaggactgacccatgtgactagccttcagggagggcatgctgctacagtccgttctttctgttggaatgtgcaagatgattctttgttgactggaggagaagatgcacagttgttactttggaaacctggagctatagagaagacctttacaaagaaagagagtatgaaaatagcatcctctgtgcaccaacgagtacgagttcatagtaatgattcttataaaagaaggaaaaagcagtga
Sequence Length
1164
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,215 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 89, mRNA
NCBI Official Synonym Full Names
WD repeat domain 89
NCBI Official Symbol
WDR89
NCBI Official Synonym Symbols
MSTP050; C14orf150
NCBI Protein Information
WD repeat-containing protein 89
UniProt Protein Name
WD repeat-containing protein 89
Protein Family
UniProt Gene Name
WDR89
UniProt Synonym Gene Names
C14orf150
UniProt Entry Name
WDR89_HUMAN
Uniprot Description
WDR89:
Chromosomal Location of Human Ortholog: 14q23.2
Similar Products
Product Notes
The WDR89 wdr89 (Catalog #AAA1277972) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaga ttgaggaaca atttgctaat ctgcacattg ttaaatgttc cttaggaacc aaagagccca cttaccttct tggtatagac acatcaaaga ctgtccaagc aggaaaggaa aacttggttg ctgttttatg ttctaatgga tcaatcagaa tatatgataa agaaaggtta aatgtactac gagaatttag tggatatcct ggacttctta atggagtcag atttgcaaat tcctgtgaca gtgtatattc agcatgtact gatggcactg tgaaatgctg ggatgctcga gtagccagag aaaaacctgt tcagctcttc aagggttacc cttccaatat ttttatcagt tttgatatta attgtaatga tcatattatt tgtgctggta cagaaaaagt tgatgatgat gcattgttgg tgttttggga tgcaaggatg aattctcaga atttatctac aactaaagac tcacttggtg catattcaga gacacatagt gatgatgtca ctcaagtacg tttccatccc agcaatccca acatggtagt ctcaggttca tctgatggcc tggtaaatgt atttgatatt aatattgata atgaggagga tgcactggtt acaacctgta actcaatttc atcagtaagc tgtattggtt ggtctgggaa aggttataaa cagatttact gcatgacaca tgatgaagga ttttattggt gggatcttaa tcatctggac actgatgaac cagttacacg tttgaacatc caggatgtca gagaagtagt taacatgaaa gaagatgctt tggactattt gattggtggc ctatatcatg aaaagacaga cacattgcat gttattggag gaacaaacaa aggaaggatt catttgatga actgcagcat gtcaggactg acccatgtga ctagccttca gggagggcat gctgctacag tccgttcttt ctgttggaat gtgcaagatg attctttgtt gactggagga gaagatgcac agttgttact ttggaaacct ggagctatag agaagacctt tacaaagaaa gagagtatga aaatagcatc ctctgtgcac caacgagtac gagttcatag taatgattct tataaaagaa ggaaaaagca gtga. It is sometimes possible for the material contained within the vial of "WDR89, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
