Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GZMM cdna clone

GZMM cDNA Clone

Gene Names
GZMM; MET1; LMET1
Synonyms
GZMM; GZMM cDNA Clone; GZMM cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcctgcgtgtcttcactgctggtgctggccctgggggccctgtcagtaggcagctcctttgggacccagatcatcgggggccgggaggtgatcccccactcgcgcccgtacatggcctcactgcagagaaatggctcccacctgtgcgggggtgtcctggtgcacccaaagtgggtgctgacggctgcccactgcctggcccagcggatggcccagctgaggctggtgctggggctccacaccctggacagccccggtctcaccttccacatcaaggcagccatccagcaccctcgctacaagcccgtccctgccctggagaacgacctcgcgctgcttcagctggacgggaaagtgaagcccagccggaccatccggccgttggccctgcccagtaagcgccaggtggtggcagcagggactcggtgcagcatggccggctgggggctgacccaccagggcgggcgcctgtcccgggtgctgcgggagctggacctccaagtgctggacacccgcatgtgtaacaacagccgcttctggaacggcagcctctcccccagcatggtctgcctggcggccgactccaaggaccaggctccctgcaagggtgactcgggcgggcccctggtgtgtggcaaaggccgggtgttggccggagtcctgtccttcagctccagggtctgcactgacatcttcaagcctcccgtggccaccgctgtggcgccttacgtgtcctggatcaggaaggtcaccggccgatcggcctga
Sequence Length
774
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,545 Da
NCBI Official Full Name
Homo sapiens granzyme M (lymphocyte met-ase 1), mRNA
NCBI Official Synonym Full Names
granzyme M
NCBI Official Symbol
GZMM
NCBI Official Synonym Symbols
MET1; LMET1
NCBI Protein Information
granzyme M
UniProt Protein Name
Granzyme M
Protein Family
UniProt Gene Name
GZMM
UniProt Synonym Gene Names
MET1; Hu-Met-1
UniProt Entry Name
GRAM_HUMAN

NCBI Description

Human natural killer (NK) cells and activated lymphocytes express and store a distinct subset of neutral serine proteases together with proteoglycans and other immune effector molecules in large cytoplasmic granules. These serine proteases are collectively termed granzymes and include 4 distinct gene products: granzyme A, granzyme B, granzyme H, and the protein encoded by this gene, granzyme M. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Uniprot Description

GZMM: Cleaves peptide substrates after methionine, leucine, and norleucine. Physiological substrates include EZR, alpha- tubulins and the apoptosis inhibitor BIRC5/Survivin. Promotes caspase activation and subsequent apoptosis of target cells. Belongs to the peptidase S1 family. Granzyme subfamily.

Protein type: Protease; Secreted, signal peptide; Secreted; EC 3.4.21.-

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: membrane

Molecular Function: protein binding; serine-type endopeptidase activity; serine-type peptidase activity

Biological Process: cell death

Research Articles on GZMM

Similar Products

Product Notes

The GZMM gzmm (Catalog #AAA1277922) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcct gcgtgtcttc actgctggtg ctggccctgg gggccctgtc agtaggcagc tcctttggga cccagatcat cgggggccgg gaggtgatcc cccactcgcg cccgtacatg gcctcactgc agagaaatgg ctcccacctg tgcgggggtg tcctggtgca cccaaagtgg gtgctgacgg ctgcccactg cctggcccag cggatggccc agctgaggct ggtgctgggg ctccacaccc tggacagccc cggtctcacc ttccacatca aggcagccat ccagcaccct cgctacaagc ccgtccctgc cctggagaac gacctcgcgc tgcttcagct ggacgggaaa gtgaagccca gccggaccat ccggccgttg gccctgccca gtaagcgcca ggtggtggca gcagggactc ggtgcagcat ggccggctgg gggctgaccc accagggcgg gcgcctgtcc cgggtgctgc gggagctgga cctccaagtg ctggacaccc gcatgtgtaa caacagccgc ttctggaacg gcagcctctc ccccagcatg gtctgcctgg cggccgactc caaggaccag gctccctgca agggtgactc gggcgggccc ctggtgtgtg gcaaaggccg ggtgttggcc ggagtcctgt ccttcagctc cagggtctgc actgacatct tcaagcctcc cgtggccacc gctgtggcgc cttacgtgtc ctggatcagg aaggtcaccg gccgatcggc ctga. It is sometimes possible for the material contained within the vial of "GZMM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.