Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIC8B cdna clone

RIC8B cDNA Clone

Gene Names
RIC8B; RIC8; hSyn
Synonyms
RIC8B; RIC8B cDNA Clone; RIC8B cdna clone
Ordering
For Research Use Only!
Sequence
atggatgaggagcgcgccctctacatcgtccgggccggcgaagcaggggctatcgagcgggtcctgagggattacagcgacaagcatagggctactttcaaatttgaatcaacagatgaagataaaagaaagaaactctgtgaaggcatatttaaagtccttataaaggacatcccaacaacatgtcaagtgtcctgcctggaagtactccgcattctctccagagacaaaaaggttttagttcctgtgacaactaaggaaaatatgcagatactgctgcgactagccaagctaaatgagttagatgattctttggagaaagtatcagagttcccagttattgtggagtcattaaaatgtctgtgtaatatagtgttcaacagtcagatggcacagcagctcagcctggaacttaatcttgctgcaaagctctgtaacctcctgagaaagtgcaaggaccggaaatttatcaatgacattaagtgctttgacttgcgcttgctcttccttctgtcacttttgcacaccgacatcaggtcacaattgcgctatgagctccagggactaccgctgctaacgcagatcttggaaagtgcctttagcatcaagtggaccgatgagtatgaatcggccatagaccataatggacctcctctctcacctcaggagacagactgtgccattgaggccctcaaagctctcttcaatgtgacggtagacagttggaaggtgcataaagagagtgattctcatcagttccgtgtaatggcagctgtccttcgtcattgtttactaatcgtaggtccaactgaagacaaaacagaagagctacacagcaatgcagtcaaccttttaagcaatgttccagtctcttgtttggatgttctcatttgtccgttaacccatgaagaaacagcccaagaggcaacgactctagatgaactgcccagtaataaaacagctgagaaagaaacagttttgaaaaacaataccatggtatacaatggtatgaatatggaggccattcatgttttactgaattttatggagaagagaatagacaagggaagcagctatagagagggtctaactccagttctcagcttattaaccgaatgttcccgagcccatcgaaacatccgaaaatttctcaaagatcaggttttaccaccgttgagggatgtgacaaatcgacctgaagttggctcaactgtgagaaataagctggtgcgcctcatgacacatgttgaccttggagtcaagcaaattgctgctgaattcctttttgtcctttgcaaagagagagtggatagtctgctgaaatacactggctatgggaatgctgcaggactgttggcggccaggggcctcttggctggaggaagaggagataattggtactcagaggatgaggacacagacactgaagaatacaaaaatgcaaaaccaaaagaggagttgcttaaaccaatgggactaaaacctgatgggacaataacgcctttggaggaagcactcaaccagtactctgtcatcgaagagaccagctctgacacagactaa
Sequence Length
1563
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,953 Da
NCBI Official Full Name
Homo sapiens resistance to inhibitors of cholinesterase 8 homolog B (C. elegans), mRNA
NCBI Official Synonym Full Names
RIC8 guanine nucleotide exchange factor B
NCBI Official Symbol
RIC8B
NCBI Official Synonym Symbols
RIC8; hSyn
NCBI Protein Information
synembryn-B
UniProt Protein Name
Synembryn-B
Protein Family
UniProt Gene Name
RIC8B
UniProt Synonym Gene Names
hSyn
UniProt Entry Name
RIC8B_HUMAN

Uniprot Description

Guanine nucleotide exchange factor (GEF), which can activate some, but not all, G-alpha proteins by exchanging bound GDP for free GTP. Able to potentiate G(olf)-alpha-dependent cAMP accumulation suggesting that it may be an important component for odorant signal transduction.

Research Articles on RIC8B

Similar Products

Product Notes

The RIC8B ric8b (Catalog #AAA1277918) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgagg agcgcgccct ctacatcgtc cgggccggcg aagcaggggc tatcgagcgg gtcctgaggg attacagcga caagcatagg gctactttca aatttgaatc aacagatgaa gataaaagaa agaaactctg tgaaggcata tttaaagtcc ttataaagga catcccaaca acatgtcaag tgtcctgcct ggaagtactc cgcattctct ccagagacaa aaaggtttta gttcctgtga caactaagga aaatatgcag atactgctgc gactagccaa gctaaatgag ttagatgatt ctttggagaa agtatcagag ttcccagtta ttgtggagtc attaaaatgt ctgtgtaata tagtgttcaa cagtcagatg gcacagcagc tcagcctgga acttaatctt gctgcaaagc tctgtaacct cctgagaaag tgcaaggacc ggaaatttat caatgacatt aagtgctttg acttgcgctt gctcttcctt ctgtcacttt tgcacaccga catcaggtca caattgcgct atgagctcca gggactaccg ctgctaacgc agatcttgga aagtgccttt agcatcaagt ggaccgatga gtatgaatcg gccatagacc ataatggacc tcctctctca cctcaggaga cagactgtgc cattgaggcc ctcaaagctc tcttcaatgt gacggtagac agttggaagg tgcataaaga gagtgattct catcagttcc gtgtaatggc agctgtcctt cgtcattgtt tactaatcgt aggtccaact gaagacaaaa cagaagagct acacagcaat gcagtcaacc ttttaagcaa tgttccagtc tcttgtttgg atgttctcat ttgtccgtta acccatgaag aaacagccca agaggcaacg actctagatg aactgcccag taataaaaca gctgagaaag aaacagtttt gaaaaacaat accatggtat acaatggtat gaatatggag gccattcatg ttttactgaa ttttatggag aagagaatag acaagggaag cagctataga gagggtctaa ctccagttct cagcttatta accgaatgtt cccgagccca tcgaaacatc cgaaaatttc tcaaagatca ggttttacca ccgttgaggg atgtgacaaa tcgacctgaa gttggctcaa ctgtgagaaa taagctggtg cgcctcatga cacatgttga ccttggagtc aagcaaattg ctgctgaatt cctttttgtc ctttgcaaag agagagtgga tagtctgctg aaatacactg gctatgggaa tgctgcagga ctgttggcgg ccaggggcct cttggctgga ggaagaggag ataattggta ctcagaggat gaggacacag acactgaaga atacaaaaat gcaaaaccaa aagaggagtt gcttaaacca atgggactaa aacctgatgg gacaataacg cctttggagg aagcactcaa ccagtactct gtcatcgaag agaccagctc tgacacagac taa. It is sometimes possible for the material contained within the vial of "RIC8B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.