Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP3K7 cdna clone

MAP3K7 cDNA Clone

Gene Names
MAP3K7; TAK1; MEKK7; TGF1a
Synonyms
MAP3K7; MAP3K7 cDNA Clone; MAP3K7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctacagcctctgccgcctcctcctcctcctcgtcttcggccggtgagatgatcgaagccccttcccaggtcctcaactttgaagagatcgactacaaggagatcgaggtggaagaggttgttggaagaggagcctttggagttgtttgcaaagctaagtggagagcaaaagatgttgctattaaacaaatagaaagtgaatctgagaggaaagcgtttattgtagagcttcggcagttatcccgtgtgaaccatcctaatattgtaaagctttatggagcctgcttgaatccagtgtgtcttgtgatggaatatgctgaagggggctctttatataatgtgctgcatggtgctgaaccattgccatattatactgctgcccacgcaatgagttggtgtttacagtgttcccaaggagtggcttatcttcacagcatgcaacccaaagcgctaattcacagggacctgaaaccaccaaacttactgctggttgcaggggggacagttctaaaaatttgtgattttggtacagcctgtgacattcagacacacatgaccaataacaaggggagtgctgcttggatggcacctgaagtttttgaaggtagtaattacagtgaaaaatgtgacgtcttcagctggggtattattctttgggaagtgataacgcgtcggaaaccctttgatgagattggtggcccagctttccgaatcatgtgggctgttcataatggtactcgaccaccactgataaaaaatttacctaagcccattgagagcctgatgactcgttgttggtctaaagatccttcccagcgcccttcaatggaggaaattgtgaaaataatgactcacttgatgcggtactttccaggagcagatgagccattacagtatccttgtcagtattcagatgaaggacagagcaactctgccaccagtacaggctcattcatggacattgcttctacaaatacgagtaacaaaagtgacactaatatggagcaagttcctgccacaaatgatactattaagcgcttagaatcaaaattgttgaaaaatcaggcaaagcaacagagtgaatctggacgtttaagcttgggagcctcccgtgggagcagtgtggagagcttgcccccaacctctgagggcaagaggatgagtgctgacatgtctgaaatagaagctaggatcgccgcaaccacaggcaacggacagccaagacgtagatccatccaagacttgactgtaactggaacagaacctggtcaggtgagcagtaggtcatccagtcccagtgtcagaatgattactacctcaggaccaacctcagaaaagccaactcgaagtcatccatggacccctgatgattccacagataccaatggatcagataactccatcccaatggcttatcttacactggatcaccaactacagcctctagcaccgtgcccaaactccaaagaatctatggcagtgtttgaacagcattgtaaaatggcacaagaatatatgaaagttcaaacagaaattgcattgttattacagagaaagcaagaactagttgcagaactggaccaggatgaaaaggaccagcaaaatacatctcgcctggtacaggaacataaaaagcttttagatgaaaacaaaagcctttctacttactaccagcaatgcaaaaaacaactagaggtcatcagaagtcagcagcagaaacgacaaggcacttcatga
Sequence Length
1740
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,740 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase kinase 7, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase kinase 7
NCBI Official Symbol
MAP3K7
NCBI Official Synonym Symbols
TAK1; MEKK7; TGF1a
NCBI Protein Information
mitogen-activated protein kinase kinase kinase 7
UniProt Protein Name
Mitogen-activated protein kinase kinase kinase 7
UniProt Gene Name
MAP3K7
UniProt Synonym Gene Names
TAK1; TGF-beta-activated kinase 1
UniProt Entry Name
M3K7_HUMAN

NCBI Description

The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

TAK1: a protein kinase of the MLK family. Mediates signal transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. Also activates MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced isoforms have been reported. Three splice variant isoforms have been described.

Protein type: EC 2.7.11.25; Protein kinase, TKL; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); TKL group; MLK family; TAK1 subfamily

Chromosomal Location of Human Ortholog: 6q15

Cellular Component: cytoplasm; cytosol; endosome membrane; IkappaB kinase complex; nucleus

Molecular Function: MAP kinase kinase kinase activity; protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; activation of MAPKK activity; activation of NF-kappaB transcription factor; activation of NF-kappaB-inducing kinase; I-kappaB kinase/NF-kappaB cascade; I-kappaB phosphorylation; JNK cascade; MyD88-dependent toll-like receptor signaling pathway; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-2 production; positive regulation of JNK activity; positive regulation of T cell activation; positive regulation of T cell cytokine production; stimulatory C-type lectin receptor signaling pathway; stress-activated MAPK cascade; T cell receptor signaling pathway; transforming growth factor beta receptor signaling pathway; Wnt receptor signaling pathway, calcium modulating pathway

Research Articles on MAP3K7

Similar Products

Product Notes

The MAP3K7 map3k7 (Catalog #AAA1277899) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctacag cctctgccgc ctcctcctcc tcctcgtctt cggccggtga gatgatcgaa gccccttccc aggtcctcaa ctttgaagag atcgactaca aggagatcga ggtggaagag gttgttggaa gaggagcctt tggagttgtt tgcaaagcta agtggagagc aaaagatgtt gctattaaac aaatagaaag tgaatctgag aggaaagcgt ttattgtaga gcttcggcag ttatcccgtg tgaaccatcc taatattgta aagctttatg gagcctgctt gaatccagtg tgtcttgtga tggaatatgc tgaagggggc tctttatata atgtgctgca tggtgctgaa ccattgccat attatactgc tgcccacgca atgagttggt gtttacagtg ttcccaagga gtggcttatc ttcacagcat gcaacccaaa gcgctaattc acagggacct gaaaccacca aacttactgc tggttgcagg ggggacagtt ctaaaaattt gtgattttgg tacagcctgt gacattcaga cacacatgac caataacaag gggagtgctg cttggatggc acctgaagtt tttgaaggta gtaattacag tgaaaaatgt gacgtcttca gctggggtat tattctttgg gaagtgataa cgcgtcggaa accctttgat gagattggtg gcccagcttt ccgaatcatg tgggctgttc ataatggtac tcgaccacca ctgataaaaa atttacctaa gcccattgag agcctgatga ctcgttgttg gtctaaagat ccttcccagc gcccttcaat ggaggaaatt gtgaaaataa tgactcactt gatgcggtac tttccaggag cagatgagcc attacagtat ccttgtcagt attcagatga aggacagagc aactctgcca ccagtacagg ctcattcatg gacattgctt ctacaaatac gagtaacaaa agtgacacta atatggagca agttcctgcc acaaatgata ctattaagcg cttagaatca aaattgttga aaaatcaggc aaagcaacag agtgaatctg gacgtttaag cttgggagcc tcccgtggga gcagtgtgga gagcttgccc ccaacctctg agggcaagag gatgagtgct gacatgtctg aaatagaagc taggatcgcc gcaaccacag gcaacggaca gccaagacgt agatccatcc aagacttgac tgtaactgga acagaacctg gtcaggtgag cagtaggtca tccagtccca gtgtcagaat gattactacc tcaggaccaa cctcagaaaa gccaactcga agtcatccat ggacccctga tgattccaca gataccaatg gatcagataa ctccatccca atggcttatc ttacactgga tcaccaacta cagcctctag caccgtgccc aaactccaaa gaatctatgg cagtgtttga acagcattgt aaaatggcac aagaatatat gaaagttcaa acagaaattg cattgttatt acagagaaag caagaactag ttgcagaact ggaccaggat gaaaaggacc agcaaaatac atctcgcctg gtacaggaac ataaaaagct tttagatgaa aacaaaagcc tttctactta ctaccagcaa tgcaaaaaac aactagaggt catcagaagt cagcagcaga aacgacaagg cacttcatga. It is sometimes possible for the material contained within the vial of "MAP3K7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.