Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIWIL1 cdna clone

PIWIL1 cDNA Clone

Gene Names
PIWIL1; HIWI; MIWI; PIWI; CT80.1
Synonyms
PIWIL1; PIWIL1 cDNA Clone; PIWIL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgggagagcccgagccagagccagaggaagggcccgcggtcaggagacagcgcagctggtgggctccactgccagtcagcaacctggttatattcagcctaggcctcagccgccaccagcagagggggaattatttggccgtggacggcagagaggaacagcaggaggaacagccaagtcacaaggactccagatatctgctggatttcaggagttatcgttagcagagagaggaggtcgtcgtagagattttcatgatcttggtgtgaatacaaggcagaacctagaccatgttaaagaatcaaaaacaggttcttcaggcattatagtaaggttaagcactaaccatttccggctgacatcccgtccccagtgggccttatatcagtatcacattgactataacccactgatggaagccagaagactccgttcagctcttctttttcaacacgaagatctaattggaaagtgtcatgcttttgatggaacgatattatttttacctaaaagactacagcaaaaggttactgaagtttttagtaagacccggaatggagaggatgtgaggataacgatcactttaacaaatgaacttccacctacatcaccaacttgtttgcagttctataatattattttcaggaggcttttgaaaatcatgaatttgcaacaaattggacgaaattattataacccaaatgacccaattgatattccaagtcacaggttggtgatttggcctggcttcactacttccatccttcagtatgaaaacagcatcatgctctgcactgacgttagccataaagtccttcgaagtgagactgttttggatttcatgttcaacttttatcatcagacagaagaacataaatttcaagaacaagtttccaaagaactaataggtttagttgttcttaccaagtataacaataagacatacagagtggatgatattgactgggaccagaatcccaagagcacctttaagaaagccgacggctctgaagtcagcttcttagaatactacaggaagcaatacaaccaagagatcaccgacttgaagcagcctgtcttggtcagccagcccaagagaaggcggggccctggggggacactgccagggcctgccatgctcattcctgagctctgctatcttacaggtctaactgataaaatgcgtaatgattttaacgtgatgaaagacttagccgttcatacaagactaactccagagcaaaggcagcgtgaagtgggacgactcattgattacattcataaaaacgataatgttcaaagggagcttcgagactggggtttgagctttgattccaacttactgtccttctcaggaagaattttgcaaacagaaaagattcaccaaggtggaaaaacatttgattacaatccacaatttgcagattggtccaaagaaacaagaggtgcaccattaattagtgttaatccactagataactggctgttgatctatacgcgaagaaattatgaagcagccaattcattgatacaaaatctatttaaagttacaccagccatgggcatgcaaatgaaaaaagcaataatgattgaagtggatgacagaactgaagcctacttaagagtcttacagcaaaaggtcacagcagacacccagatagttgtctgtctgttgtcaagtaatcggaaggacaaatacgatgctattaaaaaatacccgtgtacagattgccctaccccaagtcagtgtgtggtggcccgaaccttaggcaaacagcaaactgtcatggccattgctacaaagattgccctacagatgaactgcaagatgggaggagagctctggagggtggacatccccctgaagctcgtgatgatcgttggcatcgattgttaccatgacatgacagctgggcggaggtcaatcgcaggatttgttgccagcatcaatgaagggatgacccgctggttctcacgctgcatatttcaggatagaggacaggagctggtagatgggctcaaagtctgcctgcaagcggctctgagggcttggaatagctgcaatgagtacatgcccagccggatcatcgtgtaccgcgatggcgtaggagacggccagctgaaaacactggtgaactacgaagtgccacagtttttggattgtctaaaatccattggtagaggttacaaccctagactaacggtaattgtggtgaagaaaagagtgaacaccagattttttgctcagtctggaggaagacttcagaatccacttcctggaacagttattgatgtagaggttaccagaccagaatggtatgacttttttatcgtgagccaggctgtgagaagtggtagtgtttctcccacacattacaatgtcatctatgacaacagcggcctgaagccagaccacatacagcgcttgacctacaagctgtgccacatctattacaactggccaggtgtcattcgtgttcctgctccttgccagtacgcccacaagctggcttttcttgttggccagagtattcacagagagccaaatctgtcactgtcaaaccgcctttactacctctaa
Sequence Length
2586
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,484 Da
NCBI Official Full Name
Homo sapiens piwi-like 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
piwi like RNA-mediated gene silencing 1
NCBI Official Symbol
PIWIL1
NCBI Official Synonym Symbols
HIWI; MIWI; PIWI; CT80.1
NCBI Protein Information
piwi-like protein 1
UniProt Protein Name
Piwi-like protein 1
Protein Family
UniProt Gene Name
PIWIL1
UniProt Synonym Gene Names
HIWI
UniProt Entry Name
PIWL1_HUMAN

NCBI Description

This gene encodes a member of the PIWI subfamily of Argonaute proteins, evolutionarily conserved proteins containing both PAZ and Piwi motifs that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the self-renewal capacity of germline and hematopoietic stem cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

PIWIL1: Plays a central role during spermatogenesis by repressing transposable elements and prevent their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and govern the methylation and subsequent repression of transposons. Directly binds methylated piRNAs, a class of 24 to 30 nucleotide RNAs that are generated by a Dicer- independent mechanism and are primarily derived from transposons and other repeated sequence elements. Besides their function in transposable elements repression, piRNAs are probably involved in other processes during meiosis such as translation regulation. Probable component of some RISC complex, which mediates RNA cleavage and translational silencing. Also plays a role in the formation of chromatoid bodies and is required for some miRNAs stability. Isoform 3 may be a negative developmental regulator. Interacts (via Piwi domain) with DICER1, suggesting that it forms ribonucleoprotein RISC complexes. This interaction is regulated by HSP90AB1 activity. Interacts with MAEL, KIF17, PABPC1, PRMT5 and WDR77. Interacts (when methylated on arginine residues) with TDRD1, TDRKH/TDRD2, RNF17/TDRD4, TDRD6, TDRD7 and TDRD9. Isoform 3 is down-regulated in CD34(+) hematopoietic cells during differentiation. Detected in most fetal and adult tissues. Expressed in testes, specifically in germline cells; detected in spermatocytes and spermatids during spermatogenesis. Increased expression in testicular tumors originating from embryonic germ cells with retention of germ cells phenotype. No expression in testicular tumors of somatic origin, such as Sertoli cell and Leydig cell tumors. Overexpressed in gastric cancer cells. Isoform 3 is ubiquitously expressed, and specifically in CD34+ hematopoietic progenitor cells but not in more differentiated cells. Belongs to the argonaute family. Piwi subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 12q24.33

Cellular Component: cytoplasm

Molecular Function: mRNA binding; protein binding

Biological Process: RNA-mediated gene silencing; spermatid development

Research Articles on PIWIL1

Similar Products

Product Notes

The PIWIL1 piwil1 (Catalog #AAA1277816) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactggga gagcccgagc cagagccaga ggaagggccc gcggtcagga gacagcgcag ctggtgggct ccactgccag tcagcaacct ggttatattc agcctaggcc tcagccgcca ccagcagagg gggaattatt tggccgtgga cggcagagag gaacagcagg aggaacagcc aagtcacaag gactccagat atctgctgga tttcaggagt tatcgttagc agagagagga ggtcgtcgta gagattttca tgatcttggt gtgaatacaa ggcagaacct agaccatgtt aaagaatcaa aaacaggttc ttcaggcatt atagtaaggt taagcactaa ccatttccgg ctgacatccc gtccccagtg ggccttatat cagtatcaca ttgactataa cccactgatg gaagccagaa gactccgttc agctcttctt tttcaacacg aagatctaat tggaaagtgt catgcttttg atggaacgat attattttta cctaaaagac tacagcaaaa ggttactgaa gtttttagta agacccggaa tggagaggat gtgaggataa cgatcacttt aacaaatgaa cttccaccta catcaccaac ttgtttgcag ttctataata ttattttcag gaggcttttg aaaatcatga atttgcaaca aattggacga aattattata acccaaatga cccaattgat attccaagtc acaggttggt gatttggcct ggcttcacta cttccatcct tcagtatgaa aacagcatca tgctctgcac tgacgttagc cataaagtcc ttcgaagtga gactgttttg gatttcatgt tcaactttta tcatcagaca gaagaacata aatttcaaga acaagtttcc aaagaactaa taggtttagt tgttcttacc aagtataaca ataagacata cagagtggat gatattgact gggaccagaa tcccaagagc acctttaaga aagccgacgg ctctgaagtc agcttcttag aatactacag gaagcaatac aaccaagaga tcaccgactt gaagcagcct gtcttggtca gccagcccaa gagaaggcgg ggccctgggg ggacactgcc agggcctgcc atgctcattc ctgagctctg ctatcttaca ggtctaactg ataaaatgcg taatgatttt aacgtgatga aagacttagc cgttcataca agactaactc cagagcaaag gcagcgtgaa gtgggacgac tcattgatta cattcataaa aacgataatg ttcaaaggga gcttcgagac tggggtttga gctttgattc caacttactg tccttctcag gaagaatttt gcaaacagaa aagattcacc aaggtggaaa aacatttgat tacaatccac aatttgcaga ttggtccaaa gaaacaagag gtgcaccatt aattagtgtt aatccactag ataactggct gttgatctat acgcgaagaa attatgaagc agccaattca ttgatacaaa atctatttaa agttacacca gccatgggca tgcaaatgaa aaaagcaata atgattgaag tggatgacag aactgaagcc tacttaagag tcttacagca aaaggtcaca gcagacaccc agatagttgt ctgtctgttg tcaagtaatc ggaaggacaa atacgatgct attaaaaaat acccgtgtac agattgccct accccaagtc agtgtgtggt ggcccgaacc ttaggcaaac agcaaactgt catggccatt gctacaaaga ttgccctaca gatgaactgc aagatgggag gagagctctg gagggtggac atccccctga agctcgtgat gatcgttggc atcgattgtt accatgacat gacagctggg cggaggtcaa tcgcaggatt tgttgccagc atcaatgaag ggatgacccg ctggttctca cgctgcatat ttcaggatag aggacaggag ctggtagatg ggctcaaagt ctgcctgcaa gcggctctga gggcttggaa tagctgcaat gagtacatgc ccagccggat catcgtgtac cgcgatggcg taggagacgg ccagctgaaa acactggtga actacgaagt gccacagttt ttggattgtc taaaatccat tggtagaggt tacaacccta gactaacggt aattgtggtg aagaaaagag tgaacaccag attttttgct cagtctggag gaagacttca gaatccactt cctggaacag ttattgatgt agaggttacc agaccagaat ggtatgactt ttttatcgtg agccaggctg tgagaagtgg tagtgtttct cccacacatt acaatgtcat ctatgacaac agcggcctga agccagacca catacagcgc ttgacctaca agctgtgcca catctattac aactggccag gtgtcattcg tgttcctgct ccttgccagt acgcccacaa gctggctttt cttgttggcc agagtattca cagagagcca aatctgtcac tgtcaaaccg cctttactac ctctaa. It is sometimes possible for the material contained within the vial of "PIWIL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.