Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EMR1 cdna clone

EMR1 cDNA Clone

Gene Names
ADGRE1; EMR1; TM7LN3
Synonyms
EMR1; EMR1 cDNA Clone; EMR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgtggcttcaacctgctcctcttctggggatgttgtgttatgcacagctgggaagggcacataagacccacacggaaaccaaacacaaagggtaataactgtagagacagtaccttgtgcccagcttatgccacctgcaccaatacagtggacagttactattgcgcttgcaaacaaggcttcctgtccagcaatgggcaaaatcacttcaaggatccaggagtgcgatgcaaagatattgatgaatgttctcaaagcccccagccctgtggtcctaactcatcctgcaaaaacctgtcagggaggtacaagtgcagctgtttagatggtttctcttctcccactggaaatgactgggtcccaggaaagccgggcaatttctcctgtactgatatcaatgagtgcctcaccagcagcgtctgccctgagcattctgactgtgtcaactccatgggaagctacagttgcagctgtcaagttggattcatctctagaaactccacctgtgaagacgtggatgaatgtgcagatccaagagcttgcccagagcatgcaacttgtaataacactgttggaaactactcttgtttctgcaacccaggatttgaatccagcagtggccacttgagtttccagggtctcaaagcatcgtgtgaagatattgatgaatgcactgaaatgtgccccatcaattcaacatgcaccaacactcctgggagctacttttgcacctgccaccctggctttgcaccaagcaatggacagttgaatttcacagaccaaggagtggaatgtagagatattgatgagtgccgccaagatccatcaacctgtggtcctaattctatctgcaccaatgccctgggctcctacagctgtggctgcattgcaggctttcatcccaatccagaaggctcccagaaagatggcaacttcagctgccaaagggttctcttcaaatgtaaggaagatgtgatacccgataataagcagatccagcaatgccaagagggaaccgcagtgaaacctgcatatgtctccttttgtgcacaaataaataacatcttcagcgttctggacaaagtgtgtgaaaataaaacgaccgtagtttctctgaagaatacaactgagagctttgtccctgtgcttaaacaaatatccacgtggactaaattcaccaaggaagagacgtcctccctggccacagtcttcctggagagtgtggaaagcatgacactggcatctttttggaaaccctcagcaaatatcactccggctgttcggacggaatacttagacattgagagcaaagttatcaacaaagaatgcagtgaagagaatgtgacgttggacttggtagccaagggggataagatgaagatcgggtgttccacaattgaggaatctgaatccacagagaccactggtgtggcttttgtctcctttgtgggcatggaatcggttttaaatgagcgcttcttcaaagaccaccaggctcccttgaccacctctgagatcaagctgaagatgaattctcgagtcgttgggggcataatgactggagagaagaaagacggcttctcagatccaatcatctacactctggagaacattcagccaaagcagaagtttgagaggcccatctgtgtttcctggagcactgatgtgaagggtggaagatggacatcctttggctgtgtgatcctggaagcttctgagacatataccatctgcagctgtaatcagatggcaaatcttgccattatcatggcgtctggggagctcacgatgggctgcgccatcatcgcgggcttcctgcactaccttttccttgcctgcttcttctggatgctggtggaggctgtgatactgttcttgatggtcagaaacctgaaggtggtgaattacttcagctctcgcaacatcaagatgctgcacatctgtgcctttggttatgggctgccgatgctggtggtggtgatctctgccagtgtgcagccacagggctatggaatgcataatcgctgctggctgaatacagagacagggttcatctggagtttcttggggccagtttgcacagttatagtgatcaactcccttctcctgacctggaccttgtggatactgaggcagaggctttccagtgttaatgccgaagtctcaacgctaaaagacaccaggttactgaccttcaaggcctttgcccagctcttcatcctgggctgctcctgggtgctgggcatttttcagattggacctgtggcaggtgtcatggcttacctgttcaccatcatcaacagcctgcagggggccttcatcttcctcatccactgtctgctcaacggccaggtacgagaagaatacaagaggtggatcactgggaagacgaagcccagctcccagtcccagacctcaaggatcttgctgtcctccatgccatccgcttccaagacgggttaa
Sequence Length
2466
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
82,771 Da
NCBI Official Full Name
Homo sapiens egf-like module containing, mucin-like, hormone receptor-like 1, mRNA
NCBI Official Synonym Full Names
adhesion G protein-coupled receptor E1
NCBI Official Symbol
ADGRE1
NCBI Official Synonym Symbols
EMR1; TM7LN3
NCBI Protein Information
adhesion G protein-coupled receptor E1
UniProt Protein Name
Adhesion G protein-coupled receptor E1
UniProt Gene Name
ADGRE1
UniProt Entry Name
AGRE1_HUMAN

NCBI Description

This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

EMR1: Could be involved in cell-cell interactions. Belongs to the G-protein coupled receptor 2 family. LN-TM7 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 2; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: integral to plasma membrane

Biological Process: cell adhesion

Research Articles on EMR1

Similar Products

Product Notes

The EMR1 adgre1 (Catalog #AAA1277770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgtggct tcaacctgct cctcttctgg ggatgttgtg ttatgcacag ctgggaaggg cacataagac ccacacggaa accaaacaca aagggtaata actgtagaga cagtaccttg tgcccagctt atgccacctg caccaataca gtggacagtt actattgcgc ttgcaaacaa ggcttcctgt ccagcaatgg gcaaaatcac ttcaaggatc caggagtgcg atgcaaagat attgatgaat gttctcaaag cccccagccc tgtggtccta actcatcctg caaaaacctg tcagggaggt acaagtgcag ctgtttagat ggtttctctt ctcccactgg aaatgactgg gtcccaggaa agccgggcaa tttctcctgt actgatatca atgagtgcct caccagcagc gtctgccctg agcattctga ctgtgtcaac tccatgggaa gctacagttg cagctgtcaa gttggattca tctctagaaa ctccacctgt gaagacgtgg atgaatgtgc agatccaaga gcttgcccag agcatgcaac ttgtaataac actgttggaa actactcttg tttctgcaac ccaggatttg aatccagcag tggccacttg agtttccagg gtctcaaagc atcgtgtgaa gatattgatg aatgcactga aatgtgcccc atcaattcaa catgcaccaa cactcctggg agctactttt gcacctgcca ccctggcttt gcaccaagca atggacagtt gaatttcaca gaccaaggag tggaatgtag agatattgat gagtgccgcc aagatccatc aacctgtggt cctaattcta tctgcaccaa tgccctgggc tcctacagct gtggctgcat tgcaggcttt catcccaatc cagaaggctc ccagaaagat ggcaacttca gctgccaaag ggttctcttc aaatgtaagg aagatgtgat acccgataat aagcagatcc agcaatgcca agagggaacc gcagtgaaac ctgcatatgt ctccttttgt gcacaaataa ataacatctt cagcgttctg gacaaagtgt gtgaaaataa aacgaccgta gtttctctga agaatacaac tgagagcttt gtccctgtgc ttaaacaaat atccacgtgg actaaattca ccaaggaaga gacgtcctcc ctggccacag tcttcctgga gagtgtggaa agcatgacac tggcatcttt ttggaaaccc tcagcaaata tcactccggc tgttcggacg gaatacttag acattgagag caaagttatc aacaaagaat gcagtgaaga gaatgtgacg ttggacttgg tagccaaggg ggataagatg aagatcgggt gttccacaat tgaggaatct gaatccacag agaccactgg tgtggctttt gtctcctttg tgggcatgga atcggtttta aatgagcgct tcttcaaaga ccaccaggct cccttgacca cctctgagat caagctgaag atgaattctc gagtcgttgg gggcataatg actggagaga agaaagacgg cttctcagat ccaatcatct acactctgga gaacattcag ccaaagcaga agtttgagag gcccatctgt gtttcctgga gcactgatgt gaagggtgga agatggacat cctttggctg tgtgatcctg gaagcttctg agacatatac catctgcagc tgtaatcaga tggcaaatct tgccattatc atggcgtctg gggagctcac gatgggctgc gccatcatcg cgggcttcct gcactacctt ttccttgcct gcttcttctg gatgctggtg gaggctgtga tactgttctt gatggtcaga aacctgaagg tggtgaatta cttcagctct cgcaacatca agatgctgca catctgtgcc tttggttatg ggctgccgat gctggtggtg gtgatctctg ccagtgtgca gccacagggc tatggaatgc ataatcgctg ctggctgaat acagagacag ggttcatctg gagtttcttg gggccagttt gcacagttat agtgatcaac tcccttctcc tgacctggac cttgtggata ctgaggcaga ggctttccag tgttaatgcc gaagtctcaa cgctaaaaga caccaggtta ctgaccttca aggcctttgc ccagctcttc atcctgggct gctcctgggt gctgggcatt tttcagattg gacctgtggc aggtgtcatg gcttacctgt tcaccatcat caacagcctg cagggggcct tcatcttcct catccactgt ctgctcaacg gccaggtacg agaagaatac aagaggtgga tcactgggaa gacgaagccc agctcccagt cccagacctc aaggatcttg ctgtcctcca tgccatccgc ttccaagacg ggttaa. It is sometimes possible for the material contained within the vial of "EMR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.