Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGV cdna clone

PIGV cDNA Clone

Gene Names
PIGV; PIG-V; HPMRS1; GPI-MT-II
Synonyms
PIGV; PIGV cDNA Clone; PIGV cdna clone
Ordering
For Research Use Only!
Sequence
atgtggccccaggacccatcccggaaggaggtgctgaggtttgcagtcagctgccgtatcctgactctgatgctgcaggccctcttcaatgccatcatcccagatcaccatgcagaagccttctctcctcctcgcctggccccctcaggctttgtggaccaactcgtggaaggtcttctgggcggcctgtctcactgggatgctgaacacttcttgttcattgctgagcatggctacctgtatgagcacaactttgccttctttcctggtttccccttggccctgctggtggggactgaactgttgagacccttacgggggttactgagtctacgcagttgcctgctgatttcggtagcatcactcaatttcttgttcttcatgttggctgcagttgcacttcatgacctgggttgtctggttttgcactgtccccaccagtccttttatgcagctctgcttttctgtctcagccctgccaatgtcttcctggcagctggttactcagaagctttgtttgccctcctgacattcagtgccatggggcagctggagaggggccgagtctggactagtgtactcctctttgcctttgccactggggtacgctccaacgggctggtcagtgttggcttcctcatgcattctcaatgccaaggctttttctcttctctaacgatgctgaatcctctgagacagctctttaagctgatggcctctctgtttctgtcggtgttcacacttggccttccctttgccctctttcagtattatgcctacacccaattctgtctgccaggctcagcccgccccattcctgagcctttggtacagttagctgtagacaagggctaccggattgcagagggaaatgaaccgccttggtgcttctgggatgttccactaatatacagctatatccaggatgtctactggaatgttggctttttgaaatactatgagctcaagcaggtgcccaattttctactggctgcaccagtggctatactggttgcctgggcaacttggacatacgtgaccactcacccttggctctgccttacacttgggctgcaaaggagcaagaacaataagaccctagagaagcccgatcttggattcctcagtcctcaggtgtttgtgtacgtggtccacgctgcagtgctgctgctgtttggaggtctgtgcatgcatgttcaggttctcaccaggtttttgggctcctccactcctattatgtactggtttccagctcacttgcttcaggatcaagagccgctgttgagatccttaaagactgtgccttggaagcctcttgcagaggactccccaccaggacaaaaggtccccagaaatcctatcatgggacttttgtatcactggaaaacctgttctccagtcacacgatacattctaggctacttcctgacttactggctcctgggactactcctacattgcaacttcctgccttggacatga
Sequence Length
1482
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,713 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class V, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class V
NCBI Official Symbol
PIGV
NCBI Official Synonym Symbols
PIG-V; HPMRS1; GPI-MT-II
NCBI Protein Information
GPI mannosyltransferase 2
UniProt Protein Name
GPI mannosyltransferase 2
UniProt Gene Name
PIGV
UniProt Synonym Gene Names
GPI-MT-II; PIG-V
UniProt Entry Name
PIGV_HUMAN

NCBI Description

This gene encodes a mannosyltransferase enzyme involved in the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is a complex glycolipid that functions as a membrane anchor for many proteins and plays a role in multiple cellular processes including protein sorting and signal transduction. The encoded protein is localized to the endoplasmic reticulum and transfers the second mannose to the GPI backbone. Mutations in this gene are associated with hyperphosphatasia mental retardation syndrome. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

PIGV: Alpha-1,6-mannosyltransferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers the second mannose to the glycosylphosphatidylinositol during GPI precursor assembly. Defects in PIGV are the cause of hyperphosphatasia with mental retardation type 1 (HPMRS1). It is a syndrome characterized by elevated serum alkaline phosphatase, severe mental retardation, seizures, hypotonia, facial dysmorphism, and hypoplastic terminal phalanges. Belongs to the PIGV family.

Protein type: Membrane protein, multi-pass; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; EC 2.4.1.-; Membrane protein, integral; Transferase; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: endoplasmic reticulum membrane; mannosyltransferase complex

Molecular Function: glycolipid mannosyltransferase activity; mannosyltransferase activity

Biological Process: GPI anchor biosynthetic process; preassembly of GPI anchor in ER membrane

Disease: Hyperphosphatasia With Mental Retardation Syndrome 1

Research Articles on PIGV

Similar Products

Product Notes

The PIGV pigv (Catalog #AAA1277715) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcccc aggacccatc ccggaaggag gtgctgaggt ttgcagtcag ctgccgtatc ctgactctga tgctgcaggc cctcttcaat gccatcatcc cagatcacca tgcagaagcc ttctctcctc ctcgcctggc cccctcaggc tttgtggacc aactcgtgga aggtcttctg ggcggcctgt ctcactggga tgctgaacac ttcttgttca ttgctgagca tggctacctg tatgagcaca actttgcctt ctttcctggt ttccccttgg ccctgctggt ggggactgaa ctgttgagac ccttacgggg gttactgagt ctacgcagtt gcctgctgat ttcggtagca tcactcaatt tcttgttctt catgttggct gcagttgcac ttcatgacct gggttgtctg gttttgcact gtccccacca gtccttttat gcagctctgc ttttctgtct cagccctgcc aatgtcttcc tggcagctgg ttactcagaa gctttgtttg ccctcctgac attcagtgcc atggggcagc tggagagggg ccgagtctgg actagtgtac tcctctttgc ctttgccact ggggtacgct ccaacgggct ggtcagtgtt ggcttcctca tgcattctca atgccaaggc tttttctctt ctctaacgat gctgaatcct ctgagacagc tctttaagct gatggcctct ctgtttctgt cggtgttcac acttggcctt ccctttgccc tctttcagta ttatgcctac acccaattct gtctgccagg ctcagcccgc cccattcctg agcctttggt acagttagct gtagacaagg gctaccggat tgcagaggga aatgaaccgc cttggtgctt ctgggatgtt ccactaatat acagctatat ccaggatgtc tactggaatg ttggcttttt gaaatactat gagctcaagc aggtgcccaa ttttctactg gctgcaccag tggctatact ggttgcctgg gcaacttgga catacgtgac cactcaccct tggctctgcc ttacacttgg gctgcaaagg agcaagaaca ataagaccct agagaagccc gatcttggat tcctcagtcc tcaggtgttt gtgtacgtgg tccacgctgc agtgctgctg ctgtttggag gtctgtgcat gcatgttcag gttctcacca ggtttttggg ctcctccact cctattatgt actggtttcc agctcacttg cttcaggatc aagagccgct gttgagatcc ttaaagactg tgccttggaa gcctcttgca gaggactccc caccaggaca aaaggtcccc agaaatccta tcatgggact tttgtatcac tggaaaacct gttctccagt cacacgatac attctaggct acttcctgac ttactggctc ctgggactac tcctacattg caacttcctg ccttggacat ga. It is sometimes possible for the material contained within the vial of "PIGV, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.