NOC4L cdna clone
NOC4L cDNA Clone
Gene Names
NOC4L; NOC4; NET49; UTP19
Synonyms
NOC4L; NOC4L cDNA Clone; NOC4L cdna clone
Sequence
atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcggggccttgctggagcggggagagctgtttgtgggccagctgccctctgaggagatggtcatgacagggtcccagggagccacacggaagtacaaggtgtggatgagacaccgctatcacagctgctgcaatcgcttgggagagctcctgggccacccctcctttcaggtcaaggagctggccctcagcgcactcctgaagttcgtgcagctggaaggagcgcaccccctggagaagtccaagtgggaaggcaactacctgttcccccgagagctcttcaagttggtggtgggaggcctgctgtctcctgaggaggaccagagcctgctcctgtcccagttccgggagtacctggactacgacgacacccgctaccacaccatgcaggcagccgtggatgccgtggcccgggtcactggccagcaccccgaggtgccccccgccttttggaacaatgccttcacgctgctgtctgccgtgagcctgccccgccgggagcccaccgtctccagcttctatgtgaagcgggcggagctgtgggacacctggaaggttgctcacctgaaggagcacaggagggttttccaggccatgtggctcagcttcctcaagcacaagctgcccctcagcctctacaagaaggtgctgctgattgtgcatgacgccatcctgccgcagctggcgcagcccacgctcatgatcgacttcctcacccgcgcctgcgacctcgggggggccctcagcctcttggccttgaacgggctgttcatcttgattcacaaacacaacctggagtaccctgacttctaccggaagctctacggcctcttggacccctctgtctttcacgtcaagtaccgcgcccgcttcttccacctggctgacctcttcctgtcctcctcccacctccccgcctacctggtggccgccttcgccaagcggctggcccgcctggccctgacggctccccctgaggccctgctcatggtcctgcctttcatctgtaacctgctgcgccggcaccctgcctgccgggtcctcgtgcaccgtccacacggccctgagttggacgccgacccctacgaccctggagaggaggacccagcccagagccgggccttggagagctccctgtgggagcttcaggccctccagcgccactaccaccctgaggtgtccaaagccgccagcgtcatcaaccaggccctgtccatgcctgaggtcagcatcgcgccactgctggagctcacggcctacgagatctttgagcgggacctgaagaagaaggggcccgagccggtgccactggagtttatcccagcccagggcctgctgggacggccgggtgaactctgtgcccagcacttcacgctcagctga
Sequence Length
1551
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,468 Da
NCBI Official Full Name
Homo sapiens nucleolar complex associated 4 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
nucleolar complex associated 4 homolog
NCBI Official Symbol
NOC4L
NCBI Official Synonym Symbols
NOC4; NET49; UTP19
NCBI Protein Information
nucleolar complex protein 4 homolog
UniProt Protein Name
Nucleolar complex protein 4 homolog
Protein Family
UniProt Gene Name
NOC4L
UniProt Synonym Gene Names
NOC4 protein homolog
UniProt Entry Name
NOC4L_HUMAN
Uniprot Description
NOC4L: Belongs to the CBF/MAK21 family.
Protein type: Membrane protein, integral; RNA processing; Nucleolus; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12q24.33
Cellular Component: nucleolus; nucleoplasm; nucleus; small subunit processome
Molecular Function: protein binding
Biological Process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); rRNA processing
Similar Products
Product Notes
The NOC4L noc4l (Catalog #AAA1277650) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcggg agccgggcgc cgcgggagtt cgccgggctc tgggccgccg gctggaggcg gtgctggcga gccgcagtga ggccaacgcc gtgttcgaca tcctggccgt gctgcagtct gaggaccagg aggagatcca ggaagcagtc cgcacgtgca gccgtctttt cggggccttg ctggagcggg gagagctgtt tgtgggccag ctgccctctg aggagatggt catgacaggg tcccagggag ccacacggaa gtacaaggtg tggatgagac accgctatca cagctgctgc aatcgcttgg gagagctcct gggccacccc tcctttcagg tcaaggagct ggccctcagc gcactcctga agttcgtgca gctggaagga gcgcaccccc tggagaagtc caagtgggaa ggcaactacc tgttcccccg agagctcttc aagttggtgg tgggaggcct gctgtctcct gaggaggacc agagcctgct cctgtcccag ttccgggagt acctggacta cgacgacacc cgctaccaca ccatgcaggc agccgtggat gccgtggccc gggtcactgg ccagcacccc gaggtgcccc ccgccttttg gaacaatgcc ttcacgctgc tgtctgccgt gagcctgccc cgccgggagc ccaccgtctc cagcttctat gtgaagcggg cggagctgtg ggacacctgg aaggttgctc acctgaagga gcacaggagg gttttccagg ccatgtggct cagcttcctc aagcacaagc tgcccctcag cctctacaag aaggtgctgc tgattgtgca tgacgccatc ctgccgcagc tggcgcagcc cacgctcatg atcgacttcc tcacccgcgc ctgcgacctc gggggggccc tcagcctctt ggccttgaac gggctgttca tcttgattca caaacacaac ctggagtacc ctgacttcta ccggaagctc tacggcctct tggacccctc tgtctttcac gtcaagtacc gcgcccgctt cttccacctg gctgacctct tcctgtcctc ctcccacctc cccgcctacc tggtggccgc cttcgccaag cggctggccc gcctggccct gacggctccc cctgaggccc tgctcatggt cctgcctttc atctgtaacc tgctgcgccg gcaccctgcc tgccgggtcc tcgtgcaccg tccacacggc cctgagttgg acgccgaccc ctacgaccct ggagaggagg acccagccca gagccgggcc ttggagagct ccctgtggga gcttcaggcc ctccagcgcc actaccaccc tgaggtgtcc aaagccgcca gcgtcatcaa ccaggccctg tccatgcctg aggtcagcat cgcgccactg ctggagctca cggcctacga gatctttgag cgggacctga agaagaaggg gcccgagccg gtgccactgg agtttatccc agcccagggc ctgctgggac ggccgggtga actctgtgcc cagcacttca cgctcagctg a. It is sometimes possible for the material contained within the vial of "NOC4L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
