Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM49 cdna clone

TRIM49 cDNA Clone

Gene Names
TRIM49; RNF18; TRIM49A; TRIM49L2
Synonyms
TRIM49; TRIM49 cDNA Clone; TRIM49 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattctggaatcttacaggtctttcagggggaactcatctgccccctgtgcatgaactacttcatagacccggtcaccatagactgtgggcacagcttttgcaggccttgtttctacctcaactggcaagacatcccatttcttgtccagtgctctgaatgcacaaagtcaacagagcagataaacctcaaaaccaacattcatttgaagaagatggcttctcttgccagaaaagtcagtctctggctattcctgagctctgaggagcaaatgtgtggcactcacagggagacaaagaagatattctgtgaagtggacaggagcctgctctgtttgctgtgctccagctctcaggagcaccggtatcacagacaccgtcccattgagtgggctgctgaggaacaccgggagaagcttttacagaaaatgcagtctttgtgggaaaaagcttgtgaaaatcacagaaacctgaatgtggaaaccaccagaaccagatgctggaaggattatgtgaatttaaggctagaagcaattagagctgagtatcagaagatgcctgcatttcatcatgaagaagaaaaacataatttggagatgctgaaaaagaaggggaaagaaatttttcatcgacttcatttaagtaaagccaaaatggctcataggatggagattttaagaggaatgtatgaggagctgaacgaaatgtgccataaaccagatgtggagctacttcaggcttttggagacatattacacaggagtgagtccgtgctgctgcacatgccccagcctctgaatccagagctcagtgcagggcccatcactggactgagggacaggctcaaccaattccgagtgcatattactctgcatcatgaagaagccaacagtgatatctttctgtatgaaattttgagaagcatgtgtattggatgtgaccatcaagatgtaccctatttcactgcaacacctagaagttttcttgcatggggtgttcagactttcacctcgggcaaatattactgggaggtccatgtaggggactcctggaattgggcttttggtgtctgtaatatgtatcggaaggagaagaatcagaatgagaagatagatggaaaggagggactctttcttcttgggtgtattaagaatgacattcaatgcagtctctttaccacctccccacttatgctgcaatatatcccaaaacctaccagccgagtaggattattcctggattgtgaggctaagactgtgagctttgttgatgttaatcaaagctccctaatatacaccatccctaattgctctttctcacctcctctcaggcctatcttttgctgtattcacttctga
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,888 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 49, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 49
NCBI Official Symbol
TRIM49
NCBI Official Synonym Symbols
RNF18; TRIM49A; TRIM49L2
NCBI Protein Information
tripartite motif-containing protein 49
UniProt Protein Name
Tripartite motif-containing protein 49
UniProt Gene Name
TRIM49
UniProt Synonym Gene Names
RNF18
UniProt Entry Name
TRI49_HUMAN

NCBI Description

The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This gene has been found to be preferentially expressed in testis. Related pseudogenes and gene duplicates have also been identified on chromosome 11. [provided by RefSeq, Aug 2010]

Uniprot Description

TRIM49: contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This gene has been found to be preferentially expressed in testis. Related pseudogenes and gene duplicates have also been identified on chromosome 11. [provided by RefSeq, Aug 2010]

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 11p11.12-q12

Molecular Function: protein binding; protein kinase binding

Similar Products

Product Notes

The TRIM49 trim49 (Catalog #AAA1277428) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattctg gaatcttaca ggtctttcag ggggaactca tctgccccct gtgcatgaac tacttcatag acccggtcac catagactgt gggcacagct tttgcaggcc ttgtttctac ctcaactggc aagacatccc atttcttgtc cagtgctctg aatgcacaaa gtcaacagag cagataaacc tcaaaaccaa cattcatttg aagaagatgg cttctcttgc cagaaaagtc agtctctggc tattcctgag ctctgaggag caaatgtgtg gcactcacag ggagacaaag aagatattct gtgaagtgga caggagcctg ctctgtttgc tgtgctccag ctctcaggag caccggtatc acagacaccg tcccattgag tgggctgctg aggaacaccg ggagaagctt ttacagaaaa tgcagtcttt gtgggaaaaa gcttgtgaaa atcacagaaa cctgaatgtg gaaaccacca gaaccagatg ctggaaggat tatgtgaatt taaggctaga agcaattaga gctgagtatc agaagatgcc tgcatttcat catgaagaag aaaaacataa tttggagatg ctgaaaaaga aggggaaaga aatttttcat cgacttcatt taagtaaagc caaaatggct cataggatgg agattttaag aggaatgtat gaggagctga acgaaatgtg ccataaacca gatgtggagc tacttcaggc ttttggagac atattacaca ggagtgagtc cgtgctgctg cacatgcccc agcctctgaa tccagagctc agtgcagggc ccatcactgg actgagggac aggctcaacc aattccgagt gcatattact ctgcatcatg aagaagccaa cagtgatatc tttctgtatg aaattttgag aagcatgtgt attggatgtg accatcaaga tgtaccctat ttcactgcaa cacctagaag ttttcttgca tggggtgttc agactttcac ctcgggcaaa tattactggg aggtccatgt aggggactcc tggaattggg cttttggtgt ctgtaatatg tatcggaagg agaagaatca gaatgagaag atagatggaa aggagggact ctttcttctt gggtgtatta agaatgacat tcaatgcagt ctctttacca cctccccact tatgctgcaa tatatcccaa aacctaccag ccgagtagga ttattcctgg attgtgaggc taagactgtg agctttgttg atgttaatca aagctcccta atatacacca tccctaattg ctctttctca cctcctctca ggcctatctt ttgctgtatt cacttctga. It is sometimes possible for the material contained within the vial of "TRIM49, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.