Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZKSCAN3 cdna clone

ZKSCAN3 cDNA Clone

Gene Names
ZKSCAN3; ZF47; Zfp47; ZFP306; ZNF306; ZNF309; zfp-47; ZSCAN13; ZSCAN35; dJ874C20.1; dJ874C20.1.
Synonyms
ZKSCAN3; ZKSCAN3 cDNA Clone; ZKSCAN3 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagagaattaagtgaaagcacagccctggatgcccagtctacagaagaccagatggagcttctggtcataaaggtggaggaagaagaagccggttttcccagtagcccagatctgggttctgagggctcccgcgagcgcttccgaggcttccgctacccggaggctgcaggcccccgcgaggcgctgagtcggctccgagagctctgccgacagtggctgcagcctgagatgcacagcaaggagcagatcctggagctgctggtgctggagcagttcctgaccatcctgccggggaatctgcagagctgggtgcgggagcagcatccagagagcggggaggaggtggtggtgctattggagtatttggagaggcagctggatgagccggcgccgcaggtttcaggtgttgaccaggggcaagaactgctctgttgcaagatggcactattgacaccagccccagggtcacaaagtagccaatttcagctaatgaaggctctgctcaagcatgaatctgtgggatcccagcctttacaagatagagttctccaggtccccatgcttgcccatggaggatgctgcagagaagatgcagtggtagcttctaggcttactccagagtcccaggggttgttgaaagtggaagatgtggccctgaccctcacccctgaatggacacagcaggattcatctcaggggaatctctgtagagatgaaaagcaggagaaccatggcagcctggtctccctgggtgatgaaaaacagactaagagcagggacttgcctccagctgaggagcttccagaaaaggagcatgggaagatatcgtgccacctgagagaagacattgcccagattcctacatgtgcagaagctggtgaacaggagggcaggctacaaagaaagcagaaaaatgccacaggagggaggcggcacatctgccatgaatgtggaaagagttttgctcaaagctcaggcctgagtaaacacaggagaatccacactggtgagaaaccctacgaatgtgaagagtgtggcaaagccttcattgggagctctgcccttgtcattcatcagagagtccacactggtgagaagccatatgagtgtgaagaatgtggtaaggccttcagtcatagctcagaccttatcaagcatcagagaacccacactggggagaagccctatgagtgtgatgactgtgggaagaccttcagccagagctgcagcctccttgaacatcacagaatccacactggggagaagccgtatcagtgcagtatgtgtggcaaagcctttaggcgaagttcacatctcctgagacatcagaggatccatactggggataaaaatgttcaggaacctgagcagggagaggcctggaaaagtaggatggaaagccagttggaaaatgttgaaactcccatgtcttataaatgtaatgagtgtgaaagaagtttcactcagaatacaggcctcattgaacatcaaaaaatccacactggtgagaaaccctatcagtgtaatgcgtgtggaaaaggcttcacccgaatttcataccttgttcaacatcagagaagccatgtagggaaaaacatcctatcacagtga
Sequence Length
1617
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,793 Da
NCBI Official Full Name
Homo sapiens zinc finger with KRAB and SCAN domains 3, mRNA
NCBI Official Synonym Full Names
zinc finger with KRAB and SCAN domains 3
NCBI Official Symbol
ZKSCAN3
NCBI Official Synonym Symbols
ZF47; Zfp47; ZFP306; ZNF306; ZNF309; zfp-47; ZSCAN13; ZSCAN35; dJ874C20.1; dJ874C20.1.
NCBI Protein Information
zinc finger protein with KRAB and SCAN domains 3
UniProt Protein Name
Zinc finger protein with KRAB and SCAN domains 3
UniProt Gene Name
ZKSCAN3
UniProt Synonym Gene Names
ZFP47; ZNF306; ZNF309; ZSCAN13; Zf47; Zfp-47
UniProt Entry Name
ZKSC3_HUMAN

Uniprot Description

ZNF306: Acts as a transcriptional regulator. Binds to the consensus sequence 5'-[GT][AG][AGT]GGGG-3'. Associates with chromatin at the ITGB4 and VEGF promoters. Activates the transcription of genes associated with colon cancer progression. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: DNA-binding; Transcription factor; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 6p22.1

Cellular Component: cytoplasm; nucleus

Molecular Function: chromatin binding; DNA binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: lysosome organization and biogenesis; negative regulation of autophagy; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription, DNA-dependent

Research Articles on ZKSCAN3

Similar Products

Product Notes

The ZKSCAN3 zkscan3 (Catalog #AAA1277356) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagag aattaagtga aagcacagcc ctggatgccc agtctacaga agaccagatg gagcttctgg tcataaaggt ggaggaagaa gaagccggtt ttcccagtag cccagatctg ggttctgagg gctcccgcga gcgcttccga ggcttccgct acccggaggc tgcaggcccc cgcgaggcgc tgagtcggct ccgagagctc tgccgacagt ggctgcagcc tgagatgcac agcaaggagc agatcctgga gctgctggtg ctggagcagt tcctgaccat cctgccgggg aatctgcaga gctgggtgcg ggagcagcat ccagagagcg gggaggaggt ggtggtgcta ttggagtatt tggagaggca gctggatgag ccggcgccgc aggtttcagg tgttgaccag gggcaagaac tgctctgttg caagatggca ctattgacac cagccccagg gtcacaaagt agccaatttc agctaatgaa ggctctgctc aagcatgaat ctgtgggatc ccagccttta caagatagag ttctccaggt ccccatgctt gcccatggag gatgctgcag agaagatgca gtggtagctt ctaggcttac tccagagtcc caggggttgt tgaaagtgga agatgtggcc ctgaccctca cccctgaatg gacacagcag gattcatctc aggggaatct ctgtagagat gaaaagcagg agaaccatgg cagcctggtc tccctgggtg atgaaaaaca gactaagagc agggacttgc ctccagctga ggagcttcca gaaaaggagc atgggaagat atcgtgccac ctgagagaag acattgccca gattcctaca tgtgcagaag ctggtgaaca ggagggcagg ctacaaagaa agcagaaaaa tgccacagga gggaggcggc acatctgcca tgaatgtgga aagagttttg ctcaaagctc aggcctgagt aaacacagga gaatccacac tggtgagaaa ccctacgaat gtgaagagtg tggcaaagcc ttcattggga gctctgccct tgtcattcat cagagagtcc acactggtga gaagccatat gagtgtgaag aatgtggtaa ggccttcagt catagctcag accttatcaa gcatcagaga acccacactg gggagaagcc ctatgagtgt gatgactgtg ggaagacctt cagccagagc tgcagcctcc ttgaacatca cagaatccac actggggaga agccgtatca gtgcagtatg tgtggcaaag cctttaggcg aagttcacat ctcctgagac atcagaggat ccatactggg gataaaaatg ttcaggaacc tgagcaggga gaggcctgga aaagtaggat ggaaagccag ttggaaaatg ttgaaactcc catgtcttat aaatgtaatg agtgtgaaag aagtttcact cagaatacag gcctcattga acatcaaaaa atccacactg gtgagaaacc ctatcagtgt aatgcgtgtg gaaaaggctt cacccgaatt tcataccttg ttcaacatca gagaagccat gtagggaaaa acatcctatc acagtga. It is sometimes possible for the material contained within the vial of "ZKSCAN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.