Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM120A cdna clone

TMEM120A cDNA Clone

Gene Names
TMEM120A; NET29; TMPIT
Synonyms
TMEM120A; TMEM120A cDNA Clone; TMEM120A cdna clone
Ordering
For Research Use Only!
Sequence
atgcagcccccgcccccgggcccgctgggcgactgcctgcgggactgggaggatctacagcaggacttccagaacatccaggagacccatcggctctaccgcctgaagctggaggagctgaccaaacttcagaacaattgcaccagctccatcacgcggcagaagaagcggctccaggagctggccctcgccctgaagaaatgcaaaccctccctcccagcagaggccgagggggccgcacaggagctggagaaccggatgaaagagcgccaaggcctcttctttgacatggaggcctatttgcctaagaagaatggattgtacctgagcctggttctggggaacgtcaacgtcacgctcctgagcaagcaggctaagtttgcctacaaggacgagtatgagaagttcaagctctacctcaccatcatcctcatcctcatctccttcacttgccgcttcctgctcaactccagggtgacagatgctgccttcaacttcctgctggtctggtactactgcaccctgaccatccgggagagcatcctcatcaacaacggctcccggtgggcagggcgggccctgagggaggggagcatggaatggggtgccaggaccctccgggaagcaggaacaggcgctgggggtgatggtggctctctgctccaggatcaaaggctggtgggtgttccatcactacgtgtccaccttcctgtcgggagtcatgctgacgtggtccgacggtctcatgtaccagaaattccggaaccaattcctctccttttccatgtaccagagcttcgtgcagtttctccagtactactaccagagcggctgcctctaccgcctgcgggcgctgggcgagcggcacaccatggacctcactgtggagggcttccagtcctggatgtggcggggcctcaccttcctgctgccttttcttttctttggacacttctggcagctttttaa
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,916 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 120A, mRNA
NCBI Official Synonym Full Names
transmembrane protein 120A
NCBI Official Symbol
TMEM120A
NCBI Official Synonym Symbols
NET29; TMPIT
NCBI Protein Information
transmembrane protein 120A
UniProt Protein Name
Transmembrane protein 120A
Protein Family
UniProt Gene Name
TMEM120A
UniProt Synonym Gene Names
TMPIT
UniProt Entry Name
T120A_HUMAN

Uniprot Description

TMEM120A: Belongs to the TMEM120 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7q11.23

Biological Process: fat cell differentiation; protein heterooligomerization; protein homooligomerization

Similar Products

Product Notes

The TMEM120A tmem120a (Catalog #AAA1277302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcccc cgcccccggg cccgctgggc gactgcctgc gggactggga ggatctacag caggacttcc agaacatcca ggagacccat cggctctacc gcctgaagct ggaggagctg accaaacttc agaacaattg caccagctcc atcacgcggc agaagaagcg gctccaggag ctggccctcg ccctgaagaa atgcaaaccc tccctcccag cagaggccga gggggccgca caggagctgg agaaccggat gaaagagcgc caaggcctct tctttgacat ggaggcctat ttgcctaaga agaatggatt gtacctgagc ctggttctgg ggaacgtcaa cgtcacgctc ctgagcaagc aggctaagtt tgcctacaag gacgagtatg agaagttcaa gctctacctc accatcatcc tcatcctcat ctccttcact tgccgcttcc tgctcaactc cagggtgaca gatgctgcct tcaacttcct gctggtctgg tactactgca ccctgaccat ccgggagagc atcctcatca acaacggctc ccggtgggca gggcgggccc tgagggaggg gagcatggaa tggggtgcca ggaccctccg ggaagcagga acaggcgctg ggggtgatgg tggctctctg ctccaggatc aaaggctggt gggtgttcca tcactacgtg tccaccttcc tgtcgggagt catgctgacg tggtccgacg gtctcatgta ccagaaattc cggaaccaat tcctctcctt ttccatgtac cagagcttcg tgcagtttct ccagtactac taccagagcg gctgcctcta ccgcctgcgg gcgctgggcg agcggcacac catggacctc actgtggagg gcttccagtc ctggatgtgg cggggcctca ccttcctgct gccttttctt ttctttggac acttctggca gctttttaa. It is sometimes possible for the material contained within the vial of "TMEM120A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.