AKAP8L cdna clone
AKAP8L cDNA Clone
Gene Names
AKAP8L; HA95; HAP95; NAKAP; NAKAP95
Synonyms
AKAP8L; AKAP8L cDNA Clone; AKAP8L cdna clone
Sequence
atgagctacacaggctttgtccagggatctgaaaccactttgcagtcgacatactcggataccagcgctcagcccacctgtgattatggatatggaacttggaactctgggacaaatagaggctacgagggctatggctatggctatggctatggccaggataacaccaccaactatgggtatggtatggccacttcacactcttgggaaatgcctagctctgacacaaatgcaaacactagtgcctcgggtagcgccagtgccgattccgttttatccagaattaaccagcgcttagatatggtgccgcatttggagacagacatgatgcaaggaggcgtgtacggctcaggtggagaaaggtatgactcttatgagtcctgcgactcgagggccgtcctgagtgagcgcgacctgtaccggtcaggctatgactacagcgagcttgaccctgagatggaaatggcctatgagggccaatacgatgcctaccgcgaccagttccgcatgcgtggcaacgacaccttcggtcccagggcacagggctgggcccgggatgcccggagcggccggccaatggcctcaggctatgggcgcatgtgggaagaccccatgggggcccggggccagtgcatgtctggtgcctctcggctgccctccctcttctcccagaacatcatccccgagtacggcatgttccagggcatgcgaggtgggggcgccttcccgggcggctcccgctttggtttcgggtttggcaatggcatgaagcagatgaggcggacctggaagacctggaccacagccgacttccgaaccaagaagaagaagagaaagcagggcggcagtcctgatgagccagatagcaaagccacccgcacggactgctcggacaacagcgactcagacaatgatgagggcaccgagggggaagccacagagggccttgaaggcaccgaggctgtggagaagggctccagagtggacggagaggatgaggagggaaaagaggatgggagagaagaaggcaaagaggatccagagaagggggccctaaccacccaggatgaaaatggccagaccaagcgcaagttgcaggcaggcaagaagagtcaggacaagcagaaaaagcggcagcgagaccgcatggtggaaaggatccagtttgtgtgttctctgtgcaaataccggaccttctatgaggacgagatggccagccatcttgacagcaagttccacaaggaacactttaagtacgtaggcaccaagctccctaagcagacggctgactttctgcaggagtacgtcactaacaagaccaagaagacagaggagctccgaaaaaccgtggaggaccttgatggcctcatccagcaaatctacagagaccaggatctgacccaggaaattgccatggagcattttgtgaagaaggtggaggcagcccattgtgcagcctgcgacctcttcattcccatgcagtttgggatcatccagaagcatctgaagaccatggatcacaaccggaaccgcaggctcatgatggagcagtccaagaagtcctccctcatggtggcccgcagtattctcaacaacaagctcatcagcaagaagctggagcgctacctgaagggcgagaaccctttcaccgacagccccgaggaggagaaggagcaggaggaggctgagggcggtgccctggacgagggggcgcagggcgaagcggcagggatctcggagggcgcagagggcgtgccggcgcagcctcccgtgcccccagagccagcccccggggccgtgtcgccgccaccgccgccgcccccagaggaggaggaggagggcgccgtgcccttgctgggaggggcgctgcaacgccagatccgcggcatcccgggcctcgacgtggaggacgacgaggagggcggcgggggcgccccgtga
Sequence Length
1941
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,230 Da
NCBI Official Full Name
Homo sapiens A kinase (PRKA) anchor protein 8-like, mRNA
NCBI Official Synonym Full Names
A-kinase anchoring protein 8 like
NCBI Official Symbol
AKAP8L
NCBI Official Synonym Symbols
HA95; HAP95; NAKAP; NAKAP95
NCBI Protein Information
A-kinase anchor protein 8-like
UniProt Protein Name
A-kinase anchor protein 8-like
Protein Family
UniProt Gene Name
AKAP8L
UniProt Synonym Gene Names
NAKAP; NAKAP95; AKAP8-like protein; HAP95; HA95; Neighbor of AKAP95
UniProt Entry Name
AKP8L_HUMAN
Uniprot Description
AKAP8L: Could play a role in constitutive transport element (CTE)-mediated gene expression. Does not seem to be implicated in the binding of regulatory subunit II of PKA. May be involved in nuclear envelope breakdown and chromatin condensation. May regulate the initiation phase of DNA replication when associated with TMPO-beta. Belongs to the AKAP95 family.
Protein type: RNA-binding; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 19p13.12
Cellular Component: chromatin; cytoplasm; nuclear matrix; nuclear speck; nucleoplasm; nucleus
Molecular Function: DEAD/H-box RNA helicase binding; histone deacetylase binding; lamin binding; protein binding
Biological Process: mitotic chromosome condensation; mRNA processing; nuclear envelope disassembly; positive regulation of histone deacetylation; positive regulation of transcription from RNA polymerase II promoter; regulation of histone phosphorylation
Research Articles on AKAP8L
Similar Products
Product Notes
The AKAP8L akap8l (Catalog #AAA1277254) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctaca caggctttgt ccagggatct gaaaccactt tgcagtcgac atactcggat accagcgctc agcccacctg tgattatgga tatggaactt ggaactctgg gacaaataga ggctacgagg gctatggcta tggctatggc tatggccagg ataacaccac caactatggg tatggtatgg ccacttcaca ctcttgggaa atgcctagct ctgacacaaa tgcaaacact agtgcctcgg gtagcgccag tgccgattcc gttttatcca gaattaacca gcgcttagat atggtgccgc atttggagac agacatgatg caaggaggcg tgtacggctc aggtggagaa aggtatgact cttatgagtc ctgcgactcg agggccgtcc tgagtgagcg cgacctgtac cggtcaggct atgactacag cgagcttgac cctgagatgg aaatggccta tgagggccaa tacgatgcct accgcgacca gttccgcatg cgtggcaacg acaccttcgg tcccagggca cagggctggg cccgggatgc ccggagcggc cggccaatgg cctcaggcta tgggcgcatg tgggaagacc ccatgggggc ccggggccag tgcatgtctg gtgcctctcg gctgccctcc ctcttctccc agaacatcat ccccgagtac ggcatgttcc agggcatgcg aggtgggggc gccttcccgg gcggctcccg ctttggtttc gggtttggca atggcatgaa gcagatgagg cggacctgga agacctggac cacagccgac ttccgaacca agaagaagaa gagaaagcag ggcggcagtc ctgatgagcc agatagcaaa gccacccgca cggactgctc ggacaacagc gactcagaca atgatgaggg caccgagggg gaagccacag agggccttga aggcaccgag gctgtggaga agggctccag agtggacgga gaggatgagg agggaaaaga ggatgggaga gaagaaggca aagaggatcc agagaagggg gccctaacca cccaggatga aaatggccag accaagcgca agttgcaggc aggcaagaag agtcaggaca agcagaaaaa gcggcagcga gaccgcatgg tggaaaggat ccagtttgtg tgttctctgt gcaaataccg gaccttctat gaggacgaga tggccagcca tcttgacagc aagttccaca aggaacactt taagtacgta ggcaccaagc tccctaagca gacggctgac tttctgcagg agtacgtcac taacaagacc aagaagacag aggagctccg aaaaaccgtg gaggaccttg atggcctcat ccagcaaatc tacagagacc aggatctgac ccaggaaatt gccatggagc attttgtgaa gaaggtggag gcagcccatt gtgcagcctg cgacctcttc attcccatgc agtttgggat catccagaag catctgaaga ccatggatca caaccggaac cgcaggctca tgatggagca gtccaagaag tcctccctca tggtggcccg cagtattctc aacaacaagc tcatcagcaa gaagctggag cgctacctga agggcgagaa ccctttcacc gacagccccg aggaggagaa ggagcaggag gaggctgagg gcggtgccct ggacgagggg gcgcagggcg aagcggcagg gatctcggag ggcgcagagg gcgtgccggc gcagcctccc gtgcccccag agccagcccc cggggccgtg tcgccgccac cgccgccgcc cccagaggag gaggaggagg gcgccgtgcc cttgctggga ggggcgctgc aacgccagat ccgcggcatc ccgggcctcg acgtggagga cgacgaggag ggcggcgggg gcgccccgtg a. It is sometimes possible for the material contained within the vial of "AKAP8L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
