Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STOML3 cdna clone

STOML3 cDNA Clone

Gene Names
STOML3; SRO; Epb7.2l
Synonyms
STOML3; STOML3 cDNA Clone; STOML3 cdna clone
Ordering
For Research Use Only!
Sequence
atggattctagggtgtcttcacctgagaagcaagataaagagaatttcgtgggtgtcaacaataaacggcttggtgtatgtggctggatcctgttttccctctctttcctgttggtgatcattaccttccccatctccatatggatgtgcttgaagatcattaaggagtatgaacgtgctgttgtattccgtctgggacgcatccaagctgacaaagccaaggggccaggtttgatcctggtcctgccatgcatagatgtgtttgtcaaagttgacctccgaacagttacttgcaacattcctccacaagagatcctcaccagagactccgtaactactcaggtagatggagttgtctattacagaatctatagtgctgtctcagcagtggctaatgtcaacgatgtccatcaagcaacatttctgctggctcaaaccactctgagaaatgtcttagggacacagaccttgtcccagatcttagctggacgagaagagatcgcccatagcatccagactttacttgatgatgccaccgaactgtgggggatccgggtggcccgagtggaaatcaaagatgttcggattcccgtgcagttgcagagatccatggcagccgaggctgaggccacccgggaagcgagagccaaggtccttgcagctgaaggagaaatgaatgcttccaaatccctgaagtcagcctccatggtgctggctgagtctcccatagctctccagctgcgctacctgcagaccttgagcacggtagccaccgagaagaattctacgattgtgtttcctctgcccatgaatatactagagggcattggtggcgtcagctatgataaccacaagaagcttccaaataaagcctga
Sequence Length
876
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,044 Da
NCBI Official Full Name
Homo sapiens stomatin (EPB72)-like 3, mRNA
NCBI Official Synonym Full Names
stomatin like 3
NCBI Official Symbol
STOML3
NCBI Official Synonym Symbols
SRO; Epb7.2l
NCBI Protein Information
stomatin-like protein 3
UniProt Protein Name
Stomatin-like protein 3
Protein Family
UniProt Gene Name
STOML3
UniProt Synonym Gene Names
SLP-3
UniProt Entry Name
STML3_HUMAN

Uniprot Description

STOML3: Belongs to the band 7/mec-2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 13q13.3

Research Articles on STOML3

Similar Products

Product Notes

The STOML3 stoml3 (Catalog #AAA1277228) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattcta gggtgtcttc acctgagaag caagataaag agaatttcgt gggtgtcaac aataaacggc ttggtgtatg tggctggatc ctgttttccc tctctttcct gttggtgatc attaccttcc ccatctccat atggatgtgc ttgaagatca ttaaggagta tgaacgtgct gttgtattcc gtctgggacg catccaagct gacaaagcca aggggccagg tttgatcctg gtcctgccat gcatagatgt gtttgtcaaa gttgacctcc gaacagttac ttgcaacatt cctccacaag agatcctcac cagagactcc gtaactactc aggtagatgg agttgtctat tacagaatct atagtgctgt ctcagcagtg gctaatgtca acgatgtcca tcaagcaaca tttctgctgg ctcaaaccac tctgagaaat gtcttaggga cacagacctt gtcccagatc ttagctggac gagaagagat cgcccatagc atccagactt tacttgatga tgccaccgaa ctgtggggga tccgggtggc ccgagtggaa atcaaagatg ttcggattcc cgtgcagttg cagagatcca tggcagccga ggctgaggcc acccgggaag cgagagccaa ggtccttgca gctgaaggag aaatgaatgc ttccaaatcc ctgaagtcag cctccatggt gctggctgag tctcccatag ctctccagct gcgctacctg cagaccttga gcacggtagc caccgagaag aattctacga ttgtgtttcc tctgcccatg aatatactag agggcattgg tggcgtcagc tatgataacc acaagaagct tccaaataaa gcctga. It is sometimes possible for the material contained within the vial of "STOML3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.