Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNA15 cdna clone

GNA15 cDNA Clone

Gene Names
GNA15; GNA16
Synonyms
GNA15; GNA15 cDNA Clone; GNA15 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgctcgctgacctggcgctgctgcccctggtgcctgacggaggatgagaaggccgccgcccgggtggaccaggagatcaacaggatcctcttggagcagaagaagcaggaccgcggggagctgaagctgctgcttttgggcccaggcgagagcgggaagagcaccttcatcaagcagatgcggatcatccacggcgccggctactcggaggaggagcgcaagggcttccggcccctggtctaccagaacatcttcgtgtccatgcgggccatgatcgaggccatggagcggctgcagattccattcagcaggcccgagagcaagcaccacgctagcctggtcatgagccaggacccctataaagtgaccacgtttgagaagcgctacgctgcggccatgcagtggctgtggagggatgccggcatccgggcctgctatgagcgtcggcgggaattccacctgctcgattcagccgtgtactacctgtcccacctggagcgcatcaccgaggagggctacgtccccacagctcaggacgtgctccgcagccgcatgcccaccactggcatcaacgagtactgcttctccgtgcagaaaaccaacctgcggatcgtggacgtcgggggccagaagtcagagcgtaagaaatggatccattgtttcgagaacgtgatcgccctcatctacctggcctcactgagtgaatacgaccagtgcctggaggagaacaaccaggagaaccgcatgaaggagagcctcgcattgtttgggactatcctggaactaccctggttcaaaagcacatccgtcatcctctttctcaacaaaaccgacatcctggaggagaaaatccccacctcccacctggctacctatttccccagtttccagggccctaagcaggatgctgaggcagccaagaggttcatcctggacatgtacacgaggatgtacaccgggtgcgtggacggccccgagggcagcaagaagggcgcacgatcccgacgcctcttcagccactacacatgtgccacagacacacagaacatccgcaaggtcttcaaggacgtgcgggactcggtgctcgcccgctacctggacgagatcaacctgctgtga
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,568 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha 15 (Gq class), mRNA
NCBI Official Synonym Full Names
G protein subunit alpha 15
NCBI Official Symbol
GNA15
NCBI Official Synonym Symbols
GNA16
NCBI Protein Information
guanine nucleotide-binding protein subunit alpha-15
UniProt Protein Name
Guanine nucleotide-binding protein subunit alpha-15
UniProt Gene Name
GNA15
UniProt Synonym Gene Names
GNA16; G alpha-15; G-protein subunit alpha-15; G alpha-16; G-protein subunit alpha-16
UniProt Entry Name
GNA15_HUMAN

Uniprot Description

G-alpha 15: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. Belongs to the G-alpha family. G(q) subfamily.

Protein type: G protein, heterotrimeric; G protein; G protein, heterotrimeric alpha G(q)

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: plasma membrane

Molecular Function: GTPase activity; signal transducer activity

Biological Process: dopamine receptor, phospholipase C activating pathway; elevation of cytosolic calcium ion concentration; muscarinic acetylcholine receptor, phospholipase C activating pathway; phospholipase C activation; platelet activation

Research Articles on GNA15

Similar Products

Product Notes

The GNA15 gna15 (Catalog #AAA1277157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgct cgctgacctg gcgctgctgc ccctggtgcc tgacggagga tgagaaggcc gccgcccggg tggaccagga gatcaacagg atcctcttgg agcagaagaa gcaggaccgc ggggagctga agctgctgct tttgggccca ggcgagagcg ggaagagcac cttcatcaag cagatgcgga tcatccacgg cgccggctac tcggaggagg agcgcaaggg cttccggccc ctggtctacc agaacatctt cgtgtccatg cgggccatga tcgaggccat ggagcggctg cagattccat tcagcaggcc cgagagcaag caccacgcta gcctggtcat gagccaggac ccctataaag tgaccacgtt tgagaagcgc tacgctgcgg ccatgcagtg gctgtggagg gatgccggca tccgggcctg ctatgagcgt cggcgggaat tccacctgct cgattcagcc gtgtactacc tgtcccacct ggagcgcatc accgaggagg gctacgtccc cacagctcag gacgtgctcc gcagccgcat gcccaccact ggcatcaacg agtactgctt ctccgtgcag aaaaccaacc tgcggatcgt ggacgtcggg ggccagaagt cagagcgtaa gaaatggatc cattgtttcg agaacgtgat cgccctcatc tacctggcct cactgagtga atacgaccag tgcctggagg agaacaacca ggagaaccgc atgaaggaga gcctcgcatt gtttgggact atcctggaac taccctggtt caaaagcaca tccgtcatcc tctttctcaa caaaaccgac atcctggagg agaaaatccc cacctcccac ctggctacct atttccccag tttccagggc cctaagcagg atgctgaggc agccaagagg ttcatcctgg acatgtacac gaggatgtac accgggtgcg tggacggccc cgagggcagc aagaagggcg cacgatcccg acgcctcttc agccactaca catgtgccac agacacacag aacatccgca aggtcttcaa ggacgtgcgg gactcggtgc tcgcccgcta cctggacgag atcaacctgc tgtga. It is sometimes possible for the material contained within the vial of "GNA15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.