Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OSMR cdna clone

OSMR cDNA Clone

Gene Names
OSMR; OSMRB; PLCA1; IL-31RB; IL-31R-beta
Synonyms
OSMR; OSMR cDNA Clone; OSMR cdna clone
Ordering
For Research Use Only!
Sequence
atggctctatttgcagtctttcagacaacattcttcttaacattgctgtccttgaggacttaccagagtgaagtcttggctgaacgtttaccattgactcctgtatcacttaaagtttccaccaattctacgcgtcagagtttgcacttacaatggactgtccacaaccttccttatcatcaggaattgaaaatggtatttcagatccagatcagtaggattgaaacatccaatgtcatctgggtggggaattacagcaccactgtgaagtggaaccaggttctgcattggagctgggaatctgagctccctttggaatgtgccacacactttgtaagaataaagagtttggtggacgatgccaagttccctgagccaaatttctggagcaactggagttcctgggaggaagtcagtgtacaagattctactggacaggatatattgttcgttttccctaaagataagctggtggaagaaggcaccaatgttaccatttgttacgtttctaggaacattcaaaataatgtatcctgttatttggaagggaaacagattcatggagaacaacttgatccacatgtaactgcattcaacttgaatagtgtgcctttcattaggaataaatggacaaatatctattgttag
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,504 Da
NCBI Official Full Name
Homo sapiens oncostatin M receptor, mRNA
NCBI Official Synonym Full Names
oncostatin M receptor
NCBI Official Symbol
OSMR
NCBI Official Synonym Symbols
OSMRB; PLCA1; IL-31RB; IL-31R-beta
NCBI Protein Information
oncostatin-M-specific receptor subunit beta
UniProt Protein Name
Oncostatin-M-specific receptor subunit beta
UniProt Gene Name
OSMR
UniProt Synonym Gene Names
OSMRB; IL-31 receptor subunit beta; IL-31R subunit beta; IL-31R-beta; IL-31RB
UniProt Entry Name
OSMR_HUMAN

NCBI Description

This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

OSMR: Associates with IL31RA to form the IL31 receptor. Binds IL31 to activate STAT3 and possibly STAT1 and STAT5. Capable of transducing OSM-specific signaling events. Defects in OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1); also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins. Belongs to the type I cytokine receptor family. Type 2 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, cytokine; Membrane protein, integral

Chromosomal Location of Human Ortholog: 5p13.1

Cellular Component: apical plasma membrane; oncostatin-M receptor complex; plasma membrane

Molecular Function: growth factor binding; oncostatin-M receptor activity

Biological Process: positive regulation of acute inflammatory response; positive regulation of cell proliferation; response to cytokine stimulus

Disease: Amyloidosis, Primary Localized Cutaneous, 1

Research Articles on OSMR

Similar Products

Product Notes

The OSMR osmr (Catalog #AAA1277072) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctat ttgcagtctt tcagacaaca ttcttcttaa cattgctgtc cttgaggact taccagagtg aagtcttggc tgaacgttta ccattgactc ctgtatcact taaagtttcc accaattcta cgcgtcagag tttgcactta caatggactg tccacaacct tccttatcat caggaattga aaatggtatt tcagatccag atcagtagga ttgaaacatc caatgtcatc tgggtgggga attacagcac cactgtgaag tggaaccagg ttctgcattg gagctgggaa tctgagctcc ctttggaatg tgccacacac tttgtaagaa taaagagttt ggtggacgat gccaagttcc ctgagccaaa tttctggagc aactggagtt cctgggagga agtcagtgta caagattcta ctggacagga tatattgttc gttttcccta aagataagct ggtggaagaa ggcaccaatg ttaccatttg ttacgtttct aggaacattc aaaataatgt atcctgttat ttggaaggga aacagattca tggagaacaa cttgatccac atgtaactgc attcaacttg aatagtgtgc ctttcattag gaataaatgg acaaatatct attgttag. It is sometimes possible for the material contained within the vial of "OSMR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.