Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMED6 cdna clone

TMED6 cDNA Clone

Gene Names
TMED6; p24g5; PRO34237; SPLL9146
Synonyms
TMED6; TMED6 cDNA Clone; TMED6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccctttgctctttggggctgggctggtcgttctgaatctagtgacgtctgccaggagccagaagacagaacctctaagtggctctggggaccagccactcttccgtggagctgatcgatatgactttgccatcatgatacctccaggaggcacggaatgcttttggcaatttgcccaccagactggatacttctatttcagttgcgaggttcagcggacagtggggatgtcacatgaccggcatgttgctgccacggcacataacccacagggatttctcatagacacctcccagggtgttcggggccagattaacttctctacccaagagacaggtttttatcagctttgtctaagtaatcagcataatcacttcggttctgtgcaagtgtacctcaactttggggtcttctatgaggggcctgagactgatcacaaacagaaggaaagaaaacaactgaatgatactctggatgcaattgaggacggcacacaaaaggtgcagaacaatatctttcacatgtggcgatactacaactttgcccggatgaggaaaatggctgactttttccttatccaatcaaactataactacgtgaactggtggtcgacagcccagagccttgttattattctttctgggatcctgcaactgtatttcttgaagcgtctcttcaatgttccaacaactacagatacaaagaagccaagatgctaa
Sequence Length
723
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,631 Da
NCBI Official Full Name
Homo sapiens transmembrane emp24 protein transport domain containing 6, mRNA
NCBI Official Synonym Full Names
transmembrane p24 trafficking protein 6
NCBI Official Symbol
TMED6
NCBI Official Synonym Symbols
p24g5; PRO34237; SPLL9146
NCBI Protein Information
transmembrane emp24 domain-containing protein 6
UniProt Protein Name
Transmembrane emp24 domain-containing protein 6
UniProt Gene Name
TMED6
UniProt Synonym Gene Names
p24gamma5
UniProt Entry Name
TMED6_HUMAN

Uniprot Description

TMED6: Belongs to the EMP24/GP25L family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 16q22.1

Research Articles on TMED6

Similar Products

Product Notes

The TMED6 tmed6 (Catalog #AAA1277023) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccctt tgctctttgg ggctgggctg gtcgttctga atctagtgac gtctgccagg agccagaaga cagaacctct aagtggctct ggggaccagc cactcttccg tggagctgat cgatatgact ttgccatcat gatacctcca ggaggcacgg aatgcttttg gcaatttgcc caccagactg gatacttcta tttcagttgc gaggttcagc ggacagtggg gatgtcacat gaccggcatg ttgctgccac ggcacataac ccacagggat ttctcataga cacctcccag ggtgttcggg gccagattaa cttctctacc caagagacag gtttttatca gctttgtcta agtaatcagc ataatcactt cggttctgtg caagtgtacc tcaactttgg ggtcttctat gaggggcctg agactgatca caaacagaag gaaagaaaac aactgaatga tactctggat gcaattgagg acggcacaca aaaggtgcag aacaatatct ttcacatgtg gcgatactac aactttgccc ggatgaggaa aatggctgac tttttcctta tccaatcaaa ctataactac gtgaactggt ggtcgacagc ccagagcctt gttattattc tttctgggat cctgcaactg tatttcttga agcgtctctt caatgttcca acaactacag atacaaagaa gccaagatgc taa. It is sometimes possible for the material contained within the vial of "TMED6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.