Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KHK cdna clone

KHK cDNA Clone

Synonyms
KHK; KHK cDNA Clone; KHK cdna clone
Ordering
For Research Use Only!
Sequence
atggaagagaagcagatcctgtgcgtggggctagtggtgctggacgtcatcagcctggtggacaagtaccctaaggaggactcggagataaggtgtttgtcccagagatggcagcgcggaggcaacgcgtccaactcctgcaccattctctccctgctcggagccccctgtgccttcatgggctcaatggctcctggccatgttgctgattttgtcctggatgacctccgccgttattctgtggacctacgctacacagtctttcagaccacaggctccgtccccatcgccacggtcatcatcaacgaggccagtggtagccgcaccatcctatactatgacaggagcctgccagatgtgtctgctacagactttgagaaggttgatctgacccagttcaagtggatccacattgagggccggaacgcatcggagcaggtgaagatgctgcagcggatagacgcacacaacaccaggcagcctccagagcagaagatccgggtgtccgtggaggtggagaagccacgagaggagctcttccagctgtttggctacggagacgtggtgtttgtcagcaaagatgtggccaagcacttggggttccagtcagcagaggaagccttgaggggcttgtatggtcgtgtgaggaaaggggctgtgcttgtctgtgcctgggctgaggagggcgccgacgccctgggccctgatggcaaattgctccactcggatgctttcccgccaccccgcgtggtggatacactgggagctggagacaccttcaatgcctccgtcatcttcagcctctcccaggggaggagcgtgcaggaagcactgagattcgggtgccaggtggccggcaagaagtgtggcctgcagggctttgatggcatcgtgtga
Sequence Length
897
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,730 Da
NCBI Official Full Name
Homo sapiens ketohexokinase (fructokinase), mRNA
NCBI Official Synonym Full Names
ketohexokinase
NCBI Official Symbol
KHK
NCBI Protein Information
ketohexokinase
UniProt Protein Name
Ketohexokinase
Protein Family
UniProt Gene Name
KHK
UniProt Entry Name
KHK_HUMAN

NCBI Description

This gene encodes ketohexokinase that catalyzes conversion of fructose to fructose-1-phosphate. The product of this gene is the first enzyme with a specialized pathway that catabolizes dietary fructose. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

KHK iso2: Catalyzes the phosphorylation of the ketose sugar fructose to fructose-1-phosphate. Defects in KHK are the cause of fructosuria (FRUCT). Benign defect of intermediary metabolism. Belongs to the carbohydrate kinase PfkB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - fructose and mannose; EC 2.7.1.3; Transferase

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: cytoplasm; cytosol

Molecular Function: ketohexokinase activity; protein binding

Disease: Fructosuria, Essential

Research Articles on KHK

Similar Products

Product Notes

The KHK khk (Catalog #AAA1277002) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaga agcagatcct gtgcgtgggg ctagtggtgc tggacgtcat cagcctggtg gacaagtacc ctaaggagga ctcggagata aggtgtttgt cccagagatg gcagcgcgga ggcaacgcgt ccaactcctg caccattctc tccctgctcg gagccccctg tgccttcatg ggctcaatgg ctcctggcca tgttgctgat tttgtcctgg atgacctccg ccgttattct gtggacctac gctacacagt ctttcagacc acaggctccg tccccatcgc cacggtcatc atcaacgagg ccagtggtag ccgcaccatc ctatactatg acaggagcct gccagatgtg tctgctacag actttgagaa ggttgatctg acccagttca agtggatcca cattgagggc cggaacgcat cggagcaggt gaagatgctg cagcggatag acgcacacaa caccaggcag cctccagagc agaagatccg ggtgtccgtg gaggtggaga agccacgaga ggagctcttc cagctgtttg gctacggaga cgtggtgttt gtcagcaaag atgtggccaa gcacttgggg ttccagtcag cagaggaagc cttgaggggc ttgtatggtc gtgtgaggaa aggggctgtg cttgtctgtg cctgggctga ggagggcgcc gacgccctgg gccctgatgg caaattgctc cactcggatg ctttcccgcc accccgcgtg gtggatacac tgggagctgg agacaccttc aatgcctccg tcatcttcag cctctcccag gggaggagcg tgcaggaagc actgagattc gggtgccagg tggccggcaa gaagtgtggc ctgcagggct ttgatggcat cgtgtga. It is sometimes possible for the material contained within the vial of "KHK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.