Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CADM3 cdna clone

CADM3 cDNA Clone

Gene Names
CADM3; BIgR; NECL1; TSLL1; IGSF4B; Necl-1; synCAM3
Synonyms
CADM3; CADM3 cDNA Clone; CADM3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggccccagccgcctcgctcctgctcctgctcctgctgttcgcctgctgctgggcgcccggcggggccaacctctcccaggacgacagccagccctggacatctgatgaaacagtggtggctggtggcaccgtggtgctcaagtgccaagtgaaagatcacgaggactcatccctgcaatggtctaaccctgctcagcagactctctactttggggagaagagagcccttcgagataatcgaattcagctggttacctctacgccccacgagctcagcatcagcatcagcaatgtggccctggcagacgagggcgagtacacctgctcaatcttcactatgcctgtgcgaactgccaagtccctcgtcactgtgctaggaattccacagaagcccatcatcactggttataaatcttcattacgggaaaaagacacagccaccctaaactgtcagtcttctgggagcaagcctgcagcccggctcacctggagaaagggtgaccaagaactccacggagaaccaacccgcatacaggaagatcccaatggtaaaaccttcactgtcagcagctcggtgacattccaggttacccgggaggatgatggggcgagcatcgtgtgctctgtgaaccatgaatctctaaagggagctgacagatccacctctcaacgcattgaagttttatacacaccaactgcgatgattaggccagaccctccccatcctcgtgagggccagaagctgttgctacactgtgagggtcgcggcaatccagtcccccagcagtacctatgggagaaggagggcagtgtgccacccctgaagatgacccaggagagtgccctgatcttccctttcctcaacaagagtgacagtggcacctacggctgcacagccaccagcaacatgggcagctacaaggcctactacaccctcaatgttaatgaccccagtccggtgccctcctcctccagcacctaccacgccatcatcggtgggatcgtggctttcattgtcttcctgctgctcatcatgctcatcttcctcggccactacttgatccggcacaaaggaacctacctgacacatgaggcaaaaggctccgacgatgctccagacgcggacacggccatcatcaatgcagaaggcgggcagtcaggaggggacgacaagaaggaatatttcatctag
Sequence Length
1197
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,326 Da
NCBI Official Full Name
Homo sapiens cell adhesion molecule 3, mRNA
NCBI Official Synonym Full Names
cell adhesion molecule 3
NCBI Official Symbol
CADM3
NCBI Official Synonym Symbols
BIgR; NECL1; TSLL1; IGSF4B; Necl-1; synCAM3
NCBI Protein Information
cell adhesion molecule 3
UniProt Protein Name
Cell adhesion molecule 3
Protein Family
UniProt Gene Name
CADM3
UniProt Synonym Gene Names
IGSF4B; NECL1; SYNCAM3; TSLL1; IgSF4B; NECL-1; SynCAM3; TSLL1
UniProt Entry Name
CADM3_HUMAN

NCBI Description

IGSF4B is a brain-specific protein related to the calcium-independent cell-cell adhesion molecules known as nectins (see PVRL3; MIM 607147) (Kakunaga et al., 2005 [PubMed 15741237]).[supplied by OMIM, Mar 2008]

Uniprot Description

CADM3: Involved in the cell-cell adhesion. Has both calcium- independent homophilic cell-cell adhesion activity and calcium- independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. Interaction with EPB41L1 may regulate structure or function of cell-cell junctions. Belongs to the nectin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 1q21.2-q22

Cellular Component: cell-cell adherens junction; integral to plasma membrane; intercellular junction; plasma membrane

Molecular Function: cell adhesion molecule binding; protein homodimerization activity; receptor activity; receptor binding

Biological Process: cell recognition; heterophilic cell adhesion; homophilic cell adhesion

Research Articles on CADM3

Similar Products

Product Notes

The CADM3 cadm3 (Catalog #AAA1276968) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggccc cagccgcctc gctcctgctc ctgctcctgc tgttcgcctg ctgctgggcg cccggcgggg ccaacctctc ccaggacgac agccagccct ggacatctga tgaaacagtg gtggctggtg gcaccgtggt gctcaagtgc caagtgaaag atcacgagga ctcatccctg caatggtcta accctgctca gcagactctc tactttgggg agaagagagc ccttcgagat aatcgaattc agctggttac ctctacgccc cacgagctca gcatcagcat cagcaatgtg gccctggcag acgagggcga gtacacctgc tcaatcttca ctatgcctgt gcgaactgcc aagtccctcg tcactgtgct aggaattcca cagaagccca tcatcactgg ttataaatct tcattacggg aaaaagacac agccacccta aactgtcagt cttctgggag caagcctgca gcccggctca cctggagaaa gggtgaccaa gaactccacg gagaaccaac ccgcatacag gaagatccca atggtaaaac cttcactgtc agcagctcgg tgacattcca ggttacccgg gaggatgatg gggcgagcat cgtgtgctct gtgaaccatg aatctctaaa gggagctgac agatccacct ctcaacgcat tgaagtttta tacacaccaa ctgcgatgat taggccagac cctccccatc ctcgtgaggg ccagaagctg ttgctacact gtgagggtcg cggcaatcca gtcccccagc agtacctatg ggagaaggag ggcagtgtgc cacccctgaa gatgacccag gagagtgccc tgatcttccc tttcctcaac aagagtgaca gtggcaccta cggctgcaca gccaccagca acatgggcag ctacaaggcc tactacaccc tcaatgttaa tgaccccagt ccggtgccct cctcctccag cacctaccac gccatcatcg gtgggatcgt ggctttcatt gtcttcctgc tgctcatcat gctcatcttc ctcggccact acttgatccg gcacaaagga acctacctga cacatgaggc aaaaggctcc gacgatgctc cagacgcgga cacggccatc atcaatgcag aaggcgggca gtcaggaggg gacgacaaga aggaatattt catctag. It is sometimes possible for the material contained within the vial of "CADM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.