Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHOF cdna clone

RHOF cDNA Clone

Gene Names
RHOF; RIF; ARHF
Synonyms
RHOF; RHOF cDNA Clone; RHOF cdna clone
Ordering
For Research Use Only!
Sequence
atggatgcccccggggccctggcccagaccgccgcccccggtccgggcaggaaggagctgaagatcgtgatcgtgggcgacggcggctgcggcaagacctcgctgctcatggtgtacagccagggctccttccccgagcactacgccccatcggtgttcgagaagtacacggccagcgtgaccgttggcagcaaggaggtgaccctgaacctctacgacacggccgggcaagaagactatgaccggctgcggcccctgtcctaccagaacacccacctcgtgctcatctgctatgacgtcatgaatcccaccagctacgacaacgtcctcatcaagtggttccctgaggtcacgcatttctgccgcgggatccccatggtgctcatcggctgcaagacagacctgaggaaggacaaggagcagctgcggaagctccgggccgcccagctggagcccatcacctacatgcaggtgggccggggccaagaccctggggcacagccgtggctgtga
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,869 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member F (in filopodia), mRNA
NCBI Official Synonym Full Names
ras homolog family member F, filopodia associated
NCBI Official Symbol
RHOF
NCBI Official Synonym Symbols
RIF; ARHF
NCBI Protein Information
rho-related GTP-binding protein RhoF
UniProt Protein Name
Rho-related GTP-binding protein RhoF
UniProt Gene Name
RHOF
UniProt Synonym Gene Names
ARHF; RIF
UniProt Entry Name
RHOF_HUMAN

Uniprot Description

RHOF: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. Causes the formation of thin, actin-rich surface projections called filopodia. Functions cooperatively with CDC42 and Rac to generate additional structures, increasing the diversity of actin- based morphology. Belongs to the small GTPase superfamily. Rho family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; G protein, monomeric, Rho; G protein, monomeric; G protein

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytosol; plasma membrane

Biological Process: actin filament organization; regulation of small GTPase mediated signal transduction

Research Articles on RHOF

Similar Products

Product Notes

The RHOF rhof (Catalog #AAA1276947) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgccc ccggggccct ggcccagacc gccgcccccg gtccgggcag gaaggagctg aagatcgtga tcgtgggcga cggcggctgc ggcaagacct cgctgctcat ggtgtacagc cagggctcct tccccgagca ctacgcccca tcggtgttcg agaagtacac ggccagcgtg accgttggca gcaaggaggt gaccctgaac ctctacgaca cggccgggca agaagactat gaccggctgc ggcccctgtc ctaccagaac acccacctcg tgctcatctg ctatgacgtc atgaatccca ccagctacga caacgtcctc atcaagtggt tccctgaggt cacgcatttc tgccgcggga tccccatggt gctcatcggc tgcaagacag acctgaggaa ggacaaggag cagctgcgga agctccgggc cgcccagctg gagcccatca cctacatgca ggtgggccgg ggccaagacc ctggggcaca gccgtggctg tga. It is sometimes possible for the material contained within the vial of "RHOF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.