CHORDC1 cdna clone
CHORDC1 cDNA Clone
Gene Names
CHORDC1; CHP1
Synonyms
CHORDC1; CHORDC1 cDNA Clone; CHORDC1 cdna clone
Sequence
atggccttgctgtgctacaaccggggctgcggtcagcgcttcgatcctgagaccaattccgacgatgcttgcacataccacccaggtgttccggtctttcacgatgcattaaagggttggtcttgctgtaagagaagaacaactgatttttctgatttcttaagcattgtaggctgtacaaaaggtagacataatagtgagaagccacctgagccagtcaaacctgaagtcaagactactgagaagaaggagctatgtgaattaaaacccaaatttcaggaacacatcattcaagcccctaagccagtagaagcaataaaaagaccaagcccagatgaaccaatgacaaatttggaattaaaaatatctgcctccctaaaacaagcacttgataaacttaaactgtcatcagggaatgaagaaaataagaaagaagaagacaatgatgaaattaagattgggacctcatgtaagaatggagggtgttcaaagacataccagggtctagagagtctagaagaagtctgtgtatatcattctggagtacctattttccatgaggggatgaaatactggagctgttgtagaagaaaaacttctgattttaatacattcttagcccaagagggctgtacaaaagggaaacacatgtggactaaaaaagatgctgggaaaaaagttgttccatgtagacatgactggcatcagactggaggtgaagttaccatttcagtatatgctaaaaactcacttccagaacttagccgagtagaagcaaatagcacattgttaaatgtgcatattgtatttgaaggagagaaggaatttgatcaaaatgtgaaattatggggtgtgattgatgtaaagcgaagttatgtaactatgactgcaacaaagattgaaatcactatgagaaaagctgaaccgatgcagtgggcaagccttgaactgcctgcagctaaaaagcaggaaaaacaaaaagatgccacaacagattga
Sequence Length
999
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,286 Da
NCBI Official Full Name
Homo sapiens cysteine and histidine-rich domain (CHORD)-containing 1, mRNA
NCBI Official Synonym Full Names
cysteine and histidine rich domain containing 1
NCBI Official Symbol
CHORDC1
NCBI Official Synonym Symbols
CHP1
NCBI Protein Information
cysteine and histidine-rich domain-containing protein 1
UniProt Protein Name
Cysteine and histidine-rich domain-containing protein 1
Protein Family
UniProt Gene Name
CHORDC1
UniProt Synonym Gene Names
CHP1; CHORD-containing protein 1; CHP-1
UniProt Entry Name
CHRD1_HUMAN
Uniprot Description
CHORDC1: Regulates centrosome duplication, probably by inhibiting the kinase activity of ROCK2. Proposed to act as co-chaperone for HSP90. May play a role in the regulation of NOD1 via a HSP90 chaperone complex. In vitro, has intrinsic chaperone activity. This function may be achieved by inhibiting association of ROCK2 with NPM1. Involved in stress response. Prevents tumorigenesis. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Calcium-binding
Chromosomal Location of Human Ortholog: 11q14.3
Molecular Function: Hsp90 protein binding; protein binding
Research Articles on CHORDC1
Similar Products
Product Notes
The CHORDC1 chordc1 (Catalog #AAA1276862) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccttgc tgtgctacaa ccggggctgc ggtcagcgct tcgatcctga gaccaattcc gacgatgctt gcacatacca cccaggtgtt ccggtctttc acgatgcatt aaagggttgg tcttgctgta agagaagaac aactgatttt tctgatttct taagcattgt aggctgtaca aaaggtagac ataatagtga gaagccacct gagccagtca aacctgaagt caagactact gagaagaagg agctatgtga attaaaaccc aaatttcagg aacacatcat tcaagcccct aagccagtag aagcaataaa aagaccaagc ccagatgaac caatgacaaa tttggaatta aaaatatctg cctccctaaa acaagcactt gataaactta aactgtcatc agggaatgaa gaaaataaga aagaagaaga caatgatgaa attaagattg ggacctcatg taagaatgga gggtgttcaa agacatacca gggtctagag agtctagaag aagtctgtgt atatcattct ggagtaccta ttttccatga ggggatgaaa tactggagct gttgtagaag aaaaacttct gattttaata cattcttagc ccaagagggc tgtacaaaag ggaaacacat gtggactaaa aaagatgctg ggaaaaaagt tgttccatgt agacatgact ggcatcagac tggaggtgaa gttaccattt cagtatatgc taaaaactca cttccagaac ttagccgagt agaagcaaat agcacattgt taaatgtgca tattgtattt gaaggagaga aggaatttga tcaaaatgtg aaattatggg gtgtgattga tgtaaagcga agttatgtaa ctatgactgc aacaaagatt gaaatcacta tgagaaaagc tgaaccgatg cagtgggcaa gccttgaact gcctgcagct aaaaagcagg aaaaacaaaa agatgccaca acagattga. It is sometimes possible for the material contained within the vial of "CHORDC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
