Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASD1 cdna clone

RASD1 cDNA Clone

Gene Names
RASD1; AGS1; DEXRAS1; MGC:26290
Synonyms
RASD1; RASD1 cDNA Clone; RASD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaactggccgcgatgatcaagaagatgtgcccgagcgactcggagctgagtatcccggccaagaactgctatcgcatggtcatcctcggctcgtccaaggtgggcaagacggccatcgtgtcgcgcttcctcaccggccgcttcgaggacgcctacacgcctaccatcgaggacttccaccgcaagttctactccatccgcggcgaggtctaccagctcgacatcctcgacacgtccggcaaccacccgttccccgccatgcggcgcctctccatcctcacaggagacgttttcatcctggtgttcagtctggacaaccgcgactccttcgaggaggtgcagcggctcaggcagcagatcctcgacaccaagtcttgcctcaagaacaaaaccaaggagaacgtggacgtgcccctggtcatctgcggcaacaagggtgaccgcgacttctaccgcgaggtggaccagcgcgagatcgagcagctggtgggcgacgacccccagcgctgcgcctacttcgagatctcggccaagaagaacagcagcctggaccagatgttccgcgcgctcttcgccatggccaagctgcccagcgagatgagcccagacctgcaccgcaaggtctcggtgcagtactgcgacgtgctgcacaagaaggcgctgcggaacaagaagctgctgcgggccggcagcggcggcggcggcggcgacccgggcgacgcctttggcatcgtggcacccttcgcgcgccggcccagcgtacacagcgacctcatgtacatccgcgagaaggccagcgccggcagccaggccaaggacaaggagcgctgcgtcatcagctag
Sequence Length
846
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,848 Da
NCBI Official Full Name
Homo sapiens RAS, dexamethasone-induced 1, mRNA
NCBI Official Synonym Full Names
ras related dexamethasone induced 1
NCBI Official Symbol
RASD1
NCBI Official Synonym Symbols
AGS1; DEXRAS1; MGC:26290
NCBI Protein Information
dexamethasone-induced Ras-related protein 1
UniProt Protein Name
Dexamethasone-induced Ras-related protein 1
UniProt Gene Name
RASD1
UniProt Synonym Gene Names
AGS1; DEXRAS1
UniProt Entry Name
RASD1_HUMAN

NCBI Description

This gene encodes a member of the Ras superfamily of small GTPases and is induced by dexamethasone. The encoded protein is an activator of G-protein signaling and acts as a direct nucleotide exchange factor for Gi-Go proteins. This protein interacts with the neuronal nitric oxide adaptor protein CAPON, and a nuclear adaptor protein FE65, which interacts with the Alzheimer's disease amyloid precursor protein. This gene may play a role in dexamethasone-induced alterations in cell morphology, growth and cell-extracellular matrix interactions. Epigenetic inactivation of this gene is closely correlated with resistance to dexamethasone in multiple myeloma cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2011]

Uniprot Description

RASD1: Small GTPase. Negatively regulates the transcription regulation activity of the APBB1/FE65-APP complex via its interaction with APBB1/FE65. Forms a ternary complex with CAPON and NOS1. Component of a complex, at least composed of APBB1, RASD1/DEXRAS1 and APP. Interacts with APBB1/FE65. By dexamethasone. Expressed in a variety of tissues including heart, cardiovascular tissues, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, gastrointestinal and reproductive tissues. Belongs to the small GTPase superfamily. RasD family.

Protein type: G protein, monomeric, RasD; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: 17p11.2

Molecular Function: GTPase activity; protein binding

Biological Process: G-protein coupled receptor protein signaling pathway; signal transduction

Research Articles on RASD1

Similar Products

Product Notes

The RASD1 rasd1 (Catalog #AAA1276773) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaactgg ccgcgatgat caagaagatg tgcccgagcg actcggagct gagtatcccg gccaagaact gctatcgcat ggtcatcctc ggctcgtcca aggtgggcaa gacggccatc gtgtcgcgct tcctcaccgg ccgcttcgag gacgcctaca cgcctaccat cgaggacttc caccgcaagt tctactccat ccgcggcgag gtctaccagc tcgacatcct cgacacgtcc ggcaaccacc cgttccccgc catgcggcgc ctctccatcc tcacaggaga cgttttcatc ctggtgttca gtctggacaa ccgcgactcc ttcgaggagg tgcagcggct caggcagcag atcctcgaca ccaagtcttg cctcaagaac aaaaccaagg agaacgtgga cgtgcccctg gtcatctgcg gcaacaaggg tgaccgcgac ttctaccgcg aggtggacca gcgcgagatc gagcagctgg tgggcgacga cccccagcgc tgcgcctact tcgagatctc ggccaagaag aacagcagcc tggaccagat gttccgcgcg ctcttcgcca tggccaagct gcccagcgag atgagcccag acctgcaccg caaggtctcg gtgcagtact gcgacgtgct gcacaagaag gcgctgcgga acaagaagct gctgcgggcc ggcagcggcg gcggcggcgg cgacccgggc gacgcctttg gcatcgtggc acccttcgcg cgccggccca gcgtacacag cgacctcatg tacatccgcg agaaggccag cgccggcagc caggccaagg acaaggagcg ctgcgtcatc agctag. It is sometimes possible for the material contained within the vial of "RASD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.