TTC4 cdna clone
TTC4 cDNA Clone
Synonyms
TTC4; TTC4 cDNA Clone; TTC4 cdna clone
Sequence
atggaacaacctgggcaggatcccacctcagacgacgtcatggactcgttcctggaaaagttccagagccagccttaccgtggcggctttcatgaggaccagtgggagaaggaatttgaaaaggtccccctatttatgacgagagcgccatcagaaattgatcccagggagaatcctgacttggcttgtctccagtcaattatttttgatgaggagcgttctccagaagaacaggccaagacctataaagatgagggcaatgattactttaaagaaaaagactacaagaaagctgtaatttcatacactgaaggcttaaagaagaaatgtgcagatcctgatttgaatgctgtcctttataccaaccgggcagcagcacagtactatctgggcaattttcgttctgctctcaatgatgtgacagctgccagaaagctaaaaccctgccacctcaaagcaataataagaggtgccttatgccatctggaactgaaacactttgccgaggccgtgaactggtgtgatgagggactgcaaatagatgccaaagagaagaagcttctggaaatgagggctaaagcagacaagctgaagcgaattgaacagagggatgtgaggaaagccaacttgaaagaaaagaaggagaggaatcagaatgaggctttactccaggccatcaaggctaggaatatcaggctctcagaagctgcctgtgaggatgaagattcagcctcagaaggtctaggtgagcttttcctggatggactcagcactgagaacccccatggagccaggctgagtctagatggccagggcaggctgagctggcctgtgctctttctgtacccagagtatgcccagtcggacttcatctctgcttttcatgaggactccaggtttattgatcatctaatggtgatgtttggtgaaacaccctcttgggacctagagcaaaaatattgccctgataatttggaggtctactttgaggatgaggacagggcagaactataccgggtgcctgccaagagcaccttgctacaggttctacagcaccagaggtactttgtaaaagccctgacaccagcatttttggtctgtgtaggatcctctcctttttgcaagaattttctccgggggagaaaggtgtaccagatacgatga
Sequence Length
1164
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,679 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 4, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 4
NCBI Official Symbol
TTC4
NCBI Protein Information
tetratricopeptide repeat protein 4
UniProt Protein Name
Tetratricopeptide repeat protein 4
Protein Family
UniProt Gene Name
TTC4
UniProt Synonym Gene Names
TPR repeat protein 4
UniProt Entry Name
TTC4_HUMAN
NCBI Description
This gene encodes a protein that contains tetratricopeptide (TPR) repeats, which often mediate protein-protein interactions and chaperone activity. The encoded protein interacts with heat shock proteins 70 and 90. Alternative splicing results in multiple transcript variants. Naturally-occuring readthrough transcription occurs from upstream gene MROH (maestro heat-like repeat family member 7) to this gene. [provided by RefSeq, Apr 2014]
Uniprot Description
TTC4: a protein that contains tetratricopeptide (TPR) repeats. The 34-amino acid tetratricopeptide repeat motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity.[provided by RefSeq, Jun 2011]
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 1p32.3
Research Articles on TTC4
Similar Products
Product Notes
The TTC4 ttc4 (Catalog #AAA1276614) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacaac ctgggcagga tcccacctca gacgacgtca tggactcgtt cctggaaaag ttccagagcc agccttaccg tggcggcttt catgaggacc agtgggagaa ggaatttgaa aaggtccccc tatttatgac gagagcgcca tcagaaattg atcccaggga gaatcctgac ttggcttgtc tccagtcaat tatttttgat gaggagcgtt ctccagaaga acaggccaag acctataaag atgagggcaa tgattacttt aaagaaaaag actacaagaa agctgtaatt tcatacactg aaggcttaaa gaagaaatgt gcagatcctg atttgaatgc tgtcctttat accaaccggg cagcagcaca gtactatctg ggcaattttc gttctgctct caatgatgtg acagctgcca gaaagctaaa accctgccac ctcaaagcaa taataagagg tgccttatgc catctggaac tgaaacactt tgccgaggcc gtgaactggt gtgatgaggg actgcaaata gatgccaaag agaagaagct tctggaaatg agggctaaag cagacaagct gaagcgaatt gaacagaggg atgtgaggaa agccaacttg aaagaaaaga aggagaggaa tcagaatgag gctttactcc aggccatcaa ggctaggaat atcaggctct cagaagctgc ctgtgaggat gaagattcag cctcagaagg tctaggtgag cttttcctgg atggactcag cactgagaac ccccatggag ccaggctgag tctagatggc cagggcaggc tgagctggcc tgtgctcttt ctgtacccag agtatgccca gtcggacttc atctctgctt ttcatgagga ctccaggttt attgatcatc taatggtgat gtttggtgaa acaccctctt gggacctaga gcaaaaatat tgccctgata atttggaggt ctactttgag gatgaggaca gggcagaact ataccgggtg cctgccaaga gcaccttgct acaggttcta cagcaccaga ggtactttgt aaaagccctg acaccagcat ttttggtctg tgtaggatcc tctccttttt gcaagaattt tctccggggg agaaaggtgt accagatacg atga. It is sometimes possible for the material contained within the vial of "TTC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
