NUMBL cdna clone
NUMBL cDNA Clone
Gene Names
NUMBL; NBL; CAG3A; CTG3a; NUMBR; NUMB-R; TNRC23; NUMBLIKE
Synonyms
NUMBL; NUMBL cDNA Clone; NUMBL cdna clone
Sequence
atgaacaagttacggcagagcctgcggcggaggaagccagcctacgtgcccgaggcgtcgcgcccgcaccagtggcaggcagacgaggacgcggtgcggaagggcacgtgcagcttcccggtcaggtacctgggtcacgtggaggtagaggagtcccggggaatgcacgtgtgtgaagatgcggtgaagaagctgaaggcgatgggccgaaagtccgtgaagtctgtcctgtgggtgtcagccgatgggctccgagtggtggacgacaaaaccaaggatcttctggtcgaccagaccatcgaaaaggtctccttttgtgctcctgaccgcaacctggacaaggctttctcctatatctgtcgtgacgggactacccgccgctggatctgccactgttttctggcactgaaggactccggcgagaggctgagccacgctgtgggctgtgcttttgccgcctgcctggagcgaaaacagcgacgggagaaggaatgtggggtcacggccgccttcgatgccagccgcaccagcttcgcccgcgagggctccttccgcctgtctgggggtgggcggcctgctgagcgagaggccccggacaagaagaaagcagaggcagcagctgcccccactgtggctcctggccctgcccagcctgggcacgtgtccccgacaccagccaccacatcccctggtgagaagggtgaggcaggcacccctgtggctgcaggcaccactgcggccgccatcccccggcgccatgcacccctggagcagctggttcgccagggctccttccgtgggttcccagcactcagccagaagaactcgcctttcaaacggcagctgagcctacggctgaatgagctgccatccacgctgcagcgccgcactgacttccaggtgaagggcacagtgcctgagatggagcctcctggtgccggcgacagtgacagcatcaacgctctgtgcacacagatcagttcatcttttgccagtgctggagcgccagcaccagggccaccacctgccacaacagggacttctgcctggggtgagccctccgtgccccctgcagctgccttccagcctgggcacaagcggacaccttcagaggctgagcgatggctggaggaggtgtcacaggtggccaaggcccagcagcagcagcagcagcaacagcaacagcagcagcagcagcagcagcaacagcagcaagcagcctcagtggccccagtgcccaccatgcctcctgccctgcagcctttccccgcccccgtggggccctttgacgctgcacctgcccaagtggccgtgttcctgccacccccacacatgcagcccccttttgtgcccgcctacccgggcttgggctacccaccgatgccccgggtgcccgtggtgggcatcacaccctcacagatggtggcaaacgccttctgctcagccgcccagctccagcctcagcctgccactctgcttgggaaagctggggccttcccgccccctgccatacccagtgcccctgggagccaggcccgccctcgccccaatggggccccctggccccctgagccagcgcctgccccagctccagagttggacccctttgaggcccagtgggcggcattagaaggcaaagccactgtagagaaaccctccaaccccttttctggcgacctgcaaaagacattcgagattgaactgtag
Sequence Length
1707
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,891 Da
NCBI Official Full Name
Homo sapiens numb homolog (Drosophila)-like, mRNA
NCBI Official Synonym Full Names
NUMB like, endocytic adaptor protein
NCBI Official Symbol
NUMBL
NCBI Official Synonym Symbols
NBL; CAG3A; CTG3a; NUMBR; NUMB-R; TNRC23; NUMBLIKE
NCBI Protein Information
numb-like protein
UniProt Protein Name
Numb-like protein
Protein Family
UniProt Gene Name
NUMBL
UniProt Synonym Gene Names
Numb-R
UniProt Entry Name
NUMBL_HUMAN
Uniprot Description
NUMBL: Plays a role in the process of neurogenesis. Required throughout embryonic neurogenesis to maintain neural progenitor cells, also called radial glial cells (RGCs), by allowing their daughter cells to choose progenitor over neuronal cell fate. Not required for the proliferation of neural progenitor cells before the onset of embryonic neurogenesis. Also required postnatally in the subventricular zone (SVZ) neurogenesis by regulating SVZ neuroblasts survival and ependymal wall integrity. Negative regulator of NF-kappa-B signaling pathway. The inhibition of NF- kappa-B activation is mediated at least in part, by preventing MAP3K7IP2 to interact with polyubiquitin chains of TRAF6 and RIPK1 and by stimulating the 'Lys-48'-linked polyubiquitination and degradation of TRAF6 in cortical neurons. Interacts (via PTB domain) with MAP3K7IP2 (via C- terminal). Interacts (via C-terminal) with TRAF6 (via TRAF domains). Associates with EPS15 and NOTCH1.
Protein type: Cell development/differentiation
Chromosomal Location of Human Ortholog: 19q13.13-q13.2
Molecular Function: protein binding
Biological Process: cytokine and chemokine mediated signaling pathway; lateral ventricle development; nervous system development; neuroblast division in the subventricular zone; positive regulation of neurogenesis; protein metabolic process
Research Articles on NUMBL
Similar Products
Product Notes
The NUMBL numbl (Catalog #AAA1276475) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaagt tacggcagag cctgcggcgg aggaagccag cctacgtgcc cgaggcgtcg cgcccgcacc agtggcaggc agacgaggac gcggtgcgga agggcacgtg cagcttcccg gtcaggtacc tgggtcacgt ggaggtagag gagtcccggg gaatgcacgt gtgtgaagat gcggtgaaga agctgaaggc gatgggccga aagtccgtga agtctgtcct gtgggtgtca gccgatgggc tccgagtggt ggacgacaaa accaaggatc ttctggtcga ccagaccatc gaaaaggtct ccttttgtgc tcctgaccgc aacctggaca aggctttctc ctatatctgt cgtgacggga ctacccgccg ctggatctgc cactgttttc tggcactgaa ggactccggc gagaggctga gccacgctgt gggctgtgct tttgccgcct gcctggagcg aaaacagcga cgggagaagg aatgtggggt cacggccgcc ttcgatgcca gccgcaccag cttcgcccgc gagggctcct tccgcctgtc tgggggtggg cggcctgctg agcgagaggc cccggacaag aagaaagcag aggcagcagc tgcccccact gtggctcctg gccctgccca gcctgggcac gtgtccccga caccagccac cacatcccct ggtgagaagg gtgaggcagg cacccctgtg gctgcaggca ccactgcggc cgccatcccc cggcgccatg cacccctgga gcagctggtt cgccagggct ccttccgtgg gttcccagca ctcagccaga agaactcgcc tttcaaacgg cagctgagcc tacggctgaa tgagctgcca tccacgctgc agcgccgcac tgacttccag gtgaagggca cagtgcctga gatggagcct cctggtgccg gcgacagtga cagcatcaac gctctgtgca cacagatcag ttcatctttt gccagtgctg gagcgccagc accagggcca ccacctgcca caacagggac ttctgcctgg ggtgagccct ccgtgccccc tgcagctgcc ttccagcctg ggcacaagcg gacaccttca gaggctgagc gatggctgga ggaggtgtca caggtggcca aggcccagca gcagcagcag cagcaacagc aacagcagca gcagcagcag cagcaacagc agcaagcagc ctcagtggcc ccagtgccca ccatgcctcc tgccctgcag cctttccccg cccccgtggg gccctttgac gctgcacctg cccaagtggc cgtgttcctg ccacccccac acatgcagcc cccttttgtg cccgcctacc cgggcttggg ctacccaccg atgccccggg tgcccgtggt gggcatcaca ccctcacaga tggtggcaaa cgccttctgc tcagccgccc agctccagcc tcagcctgcc actctgcttg ggaaagctgg ggccttcccg ccccctgcca tacccagtgc ccctgggagc caggcccgcc ctcgccccaa tggggccccc tggccccctg agccagcgcc tgccccagct ccagagttgg acccctttga ggcccagtgg gcggcattag aaggcaaagc cactgtagag aaaccctcca accccttttc tggcgacctg caaaagacat tcgagattga actgtag. It is sometimes possible for the material contained within the vial of "NUMBL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
