Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP54 cdna clone

USP54 cDNA Clone

Gene Names
USP54; C10orf29; bA137L10.3; bA137L10.4
Synonyms
USP54; USP54 cDNA Clone; USP54 cdna clone
Ordering
For Research Use Only!
Sequence
atggatacagagtttggggccagttctttcttccattcacctgcttcctgccatgagtcacactcatcactatctccagagtcatctgccccacagcacagctcccccagtagatctgccttgaagcttctgacttcggttgaagtagacaacattgaaccctctgcattccacaggcaaggtttacctaaagcaccagggtggactgagaagaattctcatcatagttgggagccattggatgccccagagggtaagctgcaaggctctaggtgtgacaacagcagttgcagcaagctccctccacaagaaggaagaggcattgctcaagaacagctgttccaagaaaagaaggatcctgctaacccctccccggtgatgcctggaatagccacctctgagaggggtgatgaacacagcctaggctgtagtccttcaaattcatcagctcagcccagccttcccctgtatagaacctgccaccccataatgcctgttgcttcttcatttgtgcttcactgtcctgatcctgtgcagaaaactaaccaatgcctccaaggccaaagcctcaaaacttcattgactttaaaagtggacagaggcagtgaggagacctataggccagagtttcccagcacaaaggggcttgtccgttctctggctgagcagttccagaggatgcagggtgtctccatgagggatagtacaggtttcaaggatagaagtttgtcaggtagtctaaggaagaactcttccccttctgattctaagcctcctttctcacagggtcaagagaaaggccactggccatgggcaaagcaacaatcctctctggagggtggggatagaccactttcctgggaagagtccactgaacattcttctcttgccttaaactctgggctgcctaatggtgaaacttctagcggaggacagcccaggttggcagagccagacatataccaagagaagctgtcccaagtgagagatgttaggtctaaggatctgggcagcagtactgacttggggacttccttgcctttggattcctgggtgaatatcacaaggttctgtgattctcagcttaagcatggggcacctaggccaggaatgaagtcctcccctcatgattcccatacgtgtgtaacctatccagagagaaatcacatccttttgcatccacattggaaccaagacacagagcaggagacctcagaattggagtctctgtatcaggccagtcttcaggcttctcaagctggctgttctggatgggggcagcaggataccgcctggcacccacttagccaaacaggctctgcagatggcatggggaggaggttgcactcagcccatgatcctggtctctcaaagacttcaacagcagaaatggagcatggtctccatgaagccagaacagtgcgtacttctcagcattcatcaaacgtgaggaagcctttggaaaccgggcaccgttgttccagctcctcttccctccctgtcatccatgacccttctgtgtttctcctcggtccccaactctaccttccccaaccacagttcctgtccccagatgtcctgatgcccaccatggcaggggagcccaatagactcccaggaacttcaaggagtgtccagcagtttctggctatgtgtgacaggggtgaaacttcccaaggggccaagtacacaggaaggactttgaactaccagagcctcccccatcgctccagaacagacaactcctgggcaccctggtcagagaccaaccagcatattgggaccagattcctgactactccagggtgcaatcctcaactaacctacactgccacactaccagaaagaagcaagggccttcaggttcctcacactcagtcctggagtgatcttttccattcaccctcccaccctcccattgttcatcctgtgtacccaccatctagcagtcttcatgtacccctgaggtcagcttggaattcagatcctgttccagggtcccgaacccctggtcctcgaagagtagatatgcccccagatgatgactggaggcaaagcagttatgcctcccactctggacacaggagaacagtgggagaggggtttctgtttgttctatcagatgctcccagaagagagcagatcagggctagagtcctgcagcacagtcaatggtaa
Sequence Length
2178
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,366 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 54, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 54
NCBI Official Symbol
USP54
NCBI Official Synonym Symbols
C10orf29; bA137L10.3; bA137L10.4
NCBI Protein Information
inactive ubiquitin carboxyl-terminal hydrolase 54
UniProt Protein Name
Inactive ubiquitin carboxyl-terminal hydrolase 54
UniProt Gene Name
USP54
UniProt Synonym Gene Names
C10orf29
UniProt Entry Name
UBP54_HUMAN

Uniprot Description

USP54: Has no peptidase activity. Belongs to the peptidase C19 family. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ubiquitin-specific protease

Chromosomal Location of Human Ortholog: 10q22.2

Molecular Function: protein binding

Research Articles on USP54

Similar Products

Product Notes

The USP54 usp54 (Catalog #AAA1276451) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatacag agtttggggc cagttctttc ttccattcac ctgcttcctg ccatgagtca cactcatcac tatctccaga gtcatctgcc ccacagcaca gctcccccag tagatctgcc ttgaagcttc tgacttcggt tgaagtagac aacattgaac cctctgcatt ccacaggcaa ggtttaccta aagcaccagg gtggactgag aagaattctc atcatagttg ggagccattg gatgccccag agggtaagct gcaaggctct aggtgtgaca acagcagttg cagcaagctc cctccacaag aaggaagagg cattgctcaa gaacagctgt tccaagaaaa gaaggatcct gctaacccct ccccggtgat gcctggaata gccacctctg agaggggtga tgaacacagc ctaggctgta gtccttcaaa ttcatcagct cagcccagcc ttcccctgta tagaacctgc caccccataa tgcctgttgc ttcttcattt gtgcttcact gtcctgatcc tgtgcagaaa actaaccaat gcctccaagg ccaaagcctc aaaacttcat tgactttaaa agtggacaga ggcagtgagg agacctatag gccagagttt cccagcacaa aggggcttgt ccgttctctg gctgagcagt tccagaggat gcagggtgtc tccatgaggg atagtacagg tttcaaggat agaagtttgt caggtagtct aaggaagaac tcttcccctt ctgattctaa gcctcctttc tcacagggtc aagagaaagg ccactggcca tgggcaaagc aacaatcctc tctggagggt ggggatagac cactttcctg ggaagagtcc actgaacatt cttctcttgc cttaaactct gggctgccta atggtgaaac ttctagcgga ggacagccca ggttggcaga gccagacata taccaagaga agctgtccca agtgagagat gttaggtcta aggatctggg cagcagtact gacttgggga cttccttgcc tttggattcc tgggtgaata tcacaaggtt ctgtgattct cagcttaagc atggggcacc taggccagga atgaagtcct cccctcatga ttcccatacg tgtgtaacct atccagagag aaatcacatc cttttgcatc cacattggaa ccaagacaca gagcaggaga cctcagaatt ggagtctctg tatcaggcca gtcttcaggc ttctcaagct ggctgttctg gatgggggca gcaggatacc gcctggcacc cacttagcca aacaggctct gcagatggca tggggaggag gttgcactca gcccatgatc ctggtctctc aaagacttca acagcagaaa tggagcatgg tctccatgaa gccagaacag tgcgtacttc tcagcattca tcaaacgtga ggaagccttt ggaaaccggg caccgttgtt ccagctcctc ttccctccct gtcatccatg acccttctgt gtttctcctc ggtccccaac tctaccttcc ccaaccacag ttcctgtccc cagatgtcct gatgcccacc atggcagggg agcccaatag actcccagga acttcaagga gtgtccagca gtttctggct atgtgtgaca ggggtgaaac ttcccaaggg gccaagtaca caggaaggac tttgaactac cagagcctcc cccatcgctc cagaacagac aactcctggg caccctggtc agagaccaac cagcatattg ggaccagatt cctgactact ccagggtgca atcctcaact aacctacact gccacactac cagaaagaag caagggcctt caggttcctc acactcagtc ctggagtgat cttttccatt caccctccca ccctcccatt gttcatcctg tgtacccacc atctagcagt cttcatgtac ccctgaggtc agcttggaat tcagatcctg ttccagggtc ccgaacccct ggtcctcgaa gagtagatat gcccccagat gatgactgga ggcaaagcag ttatgcctcc cactctggac acaggagaac agtgggagag gggtttctgt ttgttctatc agatgctccc agaagagagc agatcagggc tagagtcctg cagcacagtc aatggtaa. It is sometimes possible for the material contained within the vial of "USP54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.