DDX53 cdna clone
DDX53 cDNA Clone
Gene Names
DDX53; CAGE; CT26
Synonyms
DDX53; DDX53 cDNA Clone; DDX53 cdna clone
Sequence
atgtcccactgggccccagagtggaagagggcggaggctaatccaagagaccttggggccagctgggatgtcaggggcagcagaggcagtggctggagtggccccttcggccatcagggaccgagagcagcaggctcccgtgaaccaccactctgctttaaaataaagaacaatatggttggtgtggtcattggttacagtggatcaaaaataaaagatctacaacattcgacaaacactaaaatacagatcataaacggggaatctgaagcaaaagtcagaatttttggcaatagggaaatgaaagcaaaggccaaagcggctatagaaacacttattagaaaacaagaaagctacaactcagaatccagtgtggataatgctgcatcccaaacccctattggaagaaatctaggcagaaatgacattgttggagaagctgagccattgtcaaattgggatcgcattagggcagcagtcgtggagtgcgaaaagagaaaatgggcagatctaccaccagttaagaaaaacttttacatagaatccaaagcaacaagctgcatgtctgaaatgcaggtgattaactggagaaaggaaaatttcaacataacgtgtgatgacttgaaaagtggtgaaaagcgtctcattccaaaaccaacttgcaggtttaaagacgcttttcagcaataccctgatcttctgaaaagcataataagggtagggattttaaagccaacgccaattcagtcacaggcatggccaattattctacaaggaatagatcttatagtagttgcacaaaccggaacagggaaaacattgtcctatctaatgcctgggtttattcatcttgattctcaaccaatatctagagagcaaaggaatgggcctgggatgctagtccttacacccactagagagttggctcttcacgtggaagctgaatgttcaaagtattcatataaaggtctcaaaagcatttgcatatatggtggtagaaacagaaatggacaaatagaagacattagcaaaggtgtagatatcattattgcaactcctgggaggctgaatgacctacaaatgaataactctgtcaacctaagaagcataacctacttggttatagatgaggcagataaaatgctggatatggaatttgaaccccagataaggaagattttattagatgtgcgcccagaccgacagactgttatgacaagtgcaacttggccagatactgtacgtcaactagcactttcttatttgaaagatcctatgattgtttatgttggtaatctgaatctagtggctgtaaatacagtgaagcaaaatataattgttaccacagaaaaagaaaaacgagctctcacccaagaattcgtagagaacatgtcacccaacgacaaagtcatcatgtttgtcagccaaaaacatattgctgatgacttgtcaagcgacttcaatatccaaggcatatctgcagaatcattacatggcaacagtgaacagagtgatcaagagcgagcagtagaggactttaaaagcggaaacataaagatactgattacaactgatatagtatcccgaggtcttgatcttaatgatgtcacacatgtatataattatgatttcccaaggaatattgacgtatatgtacacagagtagggtacattggacggacaggaaagactggcacatcagttaccctcatcactcagagagattcgaaaatggccggtgaattgattaaaattctggacagagcaaatcagagtgttccggaagatcttgtagtaatggctgagcaatacaagttaaatcaacaaaagaggcacagagaaacacgatcaagagaacctggacaaagacgcaaggagttttattttttaagttga
Sequence Length
1896
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
71,154 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 53, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 53
NCBI Official Symbol
DDX53
NCBI Official Synonym Symbols
CAGE; CT26
NCBI Protein Information
DEAD box protein 53
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX53
Protein Family
UniProt Gene Name
DDX53
UniProt Synonym Gene Names
CAGE; CT26
UniProt Entry Name
DDX53_HUMAN
NCBI Description
This intronless gene encodes a protein which contains several domains found in members of the DEAD-box helicase protein family. Other members of this protein family participate in ATP-dependent RNA unwinding. [provided by RefSeq, Sep 2011]
Uniprot Description
DDX53: This intronless gene encodes a protein which contains several domains found in members of the DEAD-box helicase protein family. Other members of this protein family participate in ATP-dependent RNA unwinding. [provided by RefSeq, Sep 2011]
Protein type: Helicase; Cancer Testis Antigen (CTA); EC 3.6.4.13
Chromosomal Location of Human Ortholog: Xp22.11
Molecular Function: ATP-dependent RNA helicase activity
Biological Process: RNA secondary structure unwinding
Research Articles on DDX53
Similar Products
Product Notes
The DDX53 ddx53 (Catalog #AAA1276440) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccact gggccccaga gtggaagagg gcggaggcta atccaagaga ccttggggcc agctgggatg tcaggggcag cagaggcagt ggctggagtg gccccttcgg ccatcaggga ccgagagcag caggctcccg tgaaccacca ctctgcttta aaataaagaa caatatggtt ggtgtggtca ttggttacag tggatcaaaa ataaaagatc tacaacattc gacaaacact aaaatacaga tcataaacgg ggaatctgaa gcaaaagtca gaatttttgg caatagggaa atgaaagcaa aggccaaagc ggctatagaa acacttatta gaaaacaaga aagctacaac tcagaatcca gtgtggataa tgctgcatcc caaaccccta ttggaagaaa tctaggcaga aatgacattg ttggagaagc tgagccattg tcaaattggg atcgcattag ggcagcagtc gtggagtgcg aaaagagaaa atgggcagat ctaccaccag ttaagaaaaa cttttacata gaatccaaag caacaagctg catgtctgaa atgcaggtga ttaactggag aaaggaaaat ttcaacataa cgtgtgatga cttgaaaagt ggtgaaaagc gtctcattcc aaaaccaact tgcaggttta aagacgcttt tcagcaatac cctgatcttc tgaaaagcat aataagggta gggattttaa agccaacgcc aattcagtca caggcatggc caattattct acaaggaata gatcttatag tagttgcaca aaccggaaca gggaaaacat tgtcctatct aatgcctggg tttattcatc ttgattctca accaatatct agagagcaaa ggaatgggcc tgggatgcta gtccttacac ccactagaga gttggctctt cacgtggaag ctgaatgttc aaagtattca tataaaggtc tcaaaagcat ttgcatatat ggtggtagaa acagaaatgg acaaatagaa gacattagca aaggtgtaga tatcattatt gcaactcctg ggaggctgaa tgacctacaa atgaataact ctgtcaacct aagaagcata acctacttgg ttatagatga ggcagataaa atgctggata tggaatttga accccagata aggaagattt tattagatgt gcgcccagac cgacagactg ttatgacaag tgcaacttgg ccagatactg tacgtcaact agcactttct tatttgaaag atcctatgat tgtttatgtt ggtaatctga atctagtggc tgtaaataca gtgaagcaaa atataattgt taccacagaa aaagaaaaac gagctctcac ccaagaattc gtagagaaca tgtcacccaa cgacaaagtc atcatgtttg tcagccaaaa acatattgct gatgacttgt caagcgactt caatatccaa ggcatatctg cagaatcatt acatggcaac agtgaacaga gtgatcaaga gcgagcagta gaggacttta aaagcggaaa cataaagata ctgattacaa ctgatatagt atcccgaggt cttgatctta atgatgtcac acatgtatat aattatgatt tcccaaggaa tattgacgta tatgtacaca gagtagggta cattggacgg acaggaaaga ctggcacatc agttaccctc atcactcaga gagattcgaa aatggccggt gaattgatta aaattctgga cagagcaaat cagagtgttc cggaagatct tgtagtaatg gctgagcaat acaagttaaa tcaacaaaag aggcacagag aaacacgatc aagagaacct ggacaaagac gcaaggagtt ttatttttta agttga. It is sometimes possible for the material contained within the vial of "DDX53, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
