CERCAM cdna clone
CERCAM cDNA Clone
Gene Names
CERCAM; CEECAM1; GLT25D3
Synonyms
CERCAM; CERCAM cDNA Clone; CERCAM cdna clone
Sequence
atgactgcaaagcagtgtctaggagcaggccactactgcccagagagcagaggaggaggttgttggcagggactgcagatcctgtcagacctggccaccaccttgggcatggccactctgccctctggacctgtctttcatcgggagaaaccactcagagatggatcccattccctaaaggtctcacagcaaaggagcaggactcccaggcccctgtaccctgcctggcctgattcagggccttgtggcccccagcttctgtttcaagctgggcagaccccaggatcccttccctccctaaggactcagctgaggggcccctctgcccccttctacctccacctcagcaccctcccccagcttgatgtttgggtctccccagcaccctcctccctggccggtgcaaagtacagggaggtaaagcaggacccttgcagacatgttgcccagcacacagtaggccctcaataa
Sequence Length
471
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,100 Da
NCBI Official Full Name
Homo sapiens cerebral endothelial cell adhesion molecule, mRNA
NCBI Official Synonym Full Names
cerebral endothelial cell adhesion molecule
NCBI Official Symbol
CERCAM
NCBI Official Synonym Symbols
CEECAM1; GLT25D3
NCBI Protein Information
probable inactive glycosyltransferase 25 family member 3
UniProt Protein Name
Probable inactive glycosyltransferase 25 family member 3
Protein Family
UniProt Gene Name
CERCAM
UniProt Synonym Gene Names
CEECAM1; GLT25D3; KIAA1502
UniProt Entry Name
GT253_HUMAN
Uniprot Description
CERCAM: Probable cell adhesion protein involved in leukocyte transmigration across the blood-brain barrier. Has apparently no beta-galactosyltransferase activity. Belongs to the glycosyltransferase 25 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 2.-.-.-; Transferase; Cell adhesion; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 9q34.11
Biological Process: cell adhesion; cell motility; leukocyte adhesion
Similar Products
Product Notes
The CERCAM cercam (Catalog #AAA1276348) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgcaa agcagtgtct aggagcaggc cactactgcc cagagagcag aggaggaggt tgttggcagg gactgcagat cctgtcagac ctggccacca ccttgggcat ggccactctg ccctctggac ctgtctttca tcgggagaaa ccactcagag atggatccca ttccctaaag gtctcacagc aaaggagcag gactcccagg cccctgtacc ctgcctggcc tgattcaggg ccttgtggcc cccagcttct gtttcaagct gggcagaccc caggatccct tccctcccta aggactcagc tgaggggccc ctctgccccc ttctacctcc acctcagcac cctcccccag cttgatgttt gggtctcccc agcaccctcc tccctggccg gtgcaaagta cagggaggta aagcaggacc cttgcagaca tgttgcccag cacacagtag gccctcaata a. It is sometimes possible for the material contained within the vial of "CERCAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
