Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC24B cdna clone

SEC24B cDNA Clone

Gene Names
SEC24B; SEC24
Synonyms
SEC24B; SEC24B cDNA Clone; SEC24B cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggcccccgccgggtcctctcacccggccgccagcgcccggatcccgcccaagttcggcggagcggccgtctcaggagccgcagcgcccgcgggcccgggtgcgggcccggcgccgcaccagcagaacggtccagcccagaatcaaatgcaggttccatctggatatggattgcatcatcaaaactatattgctccctcaggacattactctcaaggacctgggaaaatgacctcattgccattggatacccagtgtggtgattactactctgctctctatacagtaccaacacaaaatgtgactcctaacacagtgaaccagcaaccaggagcacagcagttgtacagcaggggtcctcctgcccctcatattgtgggatccactctaggatctttccaaggtgctgcatcgtcagcatcccatttgcatacgagtgcctcccaaccatactcctcttttgtgaatcactacaatagtccagccatgtactctgccagctcttctgttgcgtctcagggatttccctctacttgtggtcattatgctatgtcaactgtttctaatgccgcgtatcctagtgtttcatatccctctctgcctgctggtgatacatatgggcaaatgtttacctcacagaatgctccgactgttaggccagttaaagataattcattctctggtcaaaatacagctatcagccatccatcgccacttccacctctaccatcacaacagcaccaccagcagcaaagtctttcaggatacagtactctaacgtggtcatctccaggccttccatcgactcaagacaatctcatccgaaaccacacaggatccctggctgtagcgaacaacaacccaaccattactgttgcagattctttatcctgtcctgttatgcaaaatgttcagcctcccaagtccagcccagtggtatccactgttttatcaggatcctcaggatcctcatcaacaagaacacctcccactgcaaatcacccagttgagcctgtgacctcagttacacagccatcagagctattacaacaaaaaggtgttgacagctcttctaccacaagcagtgcttctccaatgcccaacagttatgatgccctggaaggaggcagttacccagatatgctttcttcatcagcaagcagtcctgctcctgatcccgcccctgaacctgatcctgcttctgctccagctccagcttcagctccagctcctgtcgtccctcagccttcaaaaatggctaagccttttggctatggctatccaacacttcagcctggttatcagaatgctacagcaccacttatttctggagtacagcccagtaacccggtatattctggattccagcagtatcctcaacagtatcctggtgtgaaccagctatcctccagtataggaggattgagtcttcagagttctccacaaccagaaagcctgagacctgtaaaccttactcaggagaggaatattttacctatgactcctgtttgggctcctgtacctaacttgaatgcagacctcaaaaaattaaactgtagcccagattcatttcggtgtactttgacaaatattccacagacacaggctttactgaataaagctaagcttcctttaggattgttgttacatcccttcagagacctaacgcaattaccagtgataacatcaaataccattgtgaggtgccgatcctgtcgaacgtatattaacccctttgtatccttcattgatcaacgtagatggaaatgcaatttgtgctatagagtaaacgatgttcctgaagaatttatgtataacccccttacccgatcttatggagagcctcataaacgaccagaagttcagaattcaactgtggagttcattgcttcttcagattacatgctgcgtcctcctcaacctgcagtttacttgtttgttttagatgtgtctcataatgcagtggaagctggatatttgacaattttgtgccagtcactcctagaaaatctagacaagcttcctggagattcacgaacaagaataggattcatgacctttgatagcactattcatttctacaatttacaagaaggattatcacagcctcaaatgttgattgtgtctgatatagatgatgtttttctacctacaccggatagtttacttgtgaatctatatgaaagtaaagagcttataaaagacttactgaatgcattaccaaacatgttcaccaatacaagagaaacacacagtgcccttggtcctgcacttcaggctgcctttaaattaatgtctccaacaggtggccgtgtgtctgtatttcagacacagttaccttccttgggtgcaggacttctgcaatccagagaagatcctaatcagagatcaagtacaaaggtggtacaacatcttggccctgcaactgatttttataagaaacttgcattagattgctcgggacagcaaactgcagtggatttgttccttttaagttcacagtattctgatcttgcttctctagcttgcatgtccaagtattctgcagggtgcatctattattatccatcattccactatactcacaatccttcacaagcagaaaagttacaaaaagacctaaaacggtatctcacaagaaaaattgggtttgaagctgttatgagaataaggtgtactaaaggtctttcaatgcacacttttcacggtaacttctttgtccgttctactgatttgttatcccttgccaacatcaatcctgatgctggatttgcggtgcagttgtcaattgaagaaagtttaacagatacttccttagtatgttttcaaacagccctattatatacatcaagcaaaggtgagcggagaattagagtacatacactttgtttgccagtggtaagttcactagcagatgtatatgcgggagtggatgtacaagctgccatctgccttctggcaaacatggctgtggatcggtccgtttcatcaagtctgtcagatgcaagagatgccttagtgaatgctgtagtggactcattgtctgcatatggctcaactgtctcaaatttacagcactctgcattgatggcgcccagctccctcaagttgtttcctctctatgttttggcccttctcaaacagaaagcatttagaacgggtacaagcacacggctggatgatcgtgtatatgccatgtgtcagataaagtctcagccacttgttcatctaatgaaaatgattcatcccaacttatacaggatagacagattgacagatgagggtgcagtacatgttaatgacaggattgtaccacagccacctcttcaaaaattgtctgcagagaagctgacaagagaaggtgctttccttatggactgtggctctgttttttacatttgggttgggaaaggctgtgacaataacttcatagaggatgtgcttggatatactaattttgcatcaataccacagaaaatgacacatcttccagagctagatacactttcatcagaaagagccagatccttcataacttggcttagagacagcagaccattaagtccaatccttcacatagtaaaagatgagagtcctgccaaagcagaattttttcagcatttgattgaagaccggacagaggctgcattttcttactatgaatttttgcttcatgttcagcagcagatttgtaagtga
Sequence Length
3702
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
140,421 Da
NCBI Official Full Name
Homo sapiens SEC24 family, member B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC24 homolog B, COPII coat complex component
NCBI Official Symbol
SEC24B
NCBI Official Synonym Symbols
SEC24
NCBI Protein Information
protein transport protein Sec24B
UniProt Protein Name
Protein transport protein Sec24B
Protein Family
UniProt Gene Name
SEC24B
UniProt Entry Name
SC24B_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Uniprot Description

SEC24B: Component of the COPII coat, that covers ER-derived vesicles involved in transport from the endoplasmic reticulum to the Golgi apparatus. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the Golgi complex. COPII is composed of at least five proteins: the Sec23/24 complex, the Sec13/31 complex and SAR1. SEC24B is capable of forming heterodimers with SEC24A. Interacts with RNF139. Interacts with TMED2 and TMED10. Expressed in fibroblasts, hepatocytes, and lymphocytes. Belongs to the SEC23/SEC24 family. SEC24 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 4q25

Cellular Component: cytosol; endoplasmic reticulum membrane; membrane

Molecular Function: protein binding; transporter activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; vesicle-mediated transport

Research Articles on SEC24B

Similar Products

Product Notes

The SEC24B sec24b (Catalog #AAA1276167) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggccc ccgccgggtc ctctcacccg gccgccagcg cccggatccc gcccaagttc ggcggagcgg ccgtctcagg agccgcagcg cccgcgggcc cgggtgcggg cccggcgccg caccagcaga acggtccagc ccagaatcaa atgcaggttc catctggata tggattgcat catcaaaact atattgctcc ctcaggacat tactctcaag gacctgggaa aatgacctca ttgccattgg atacccagtg tggtgattac tactctgctc tctatacagt accaacacaa aatgtgactc ctaacacagt gaaccagcaa ccaggagcac agcagttgta cagcaggggt cctcctgccc ctcatattgt gggatccact ctaggatctt tccaaggtgc tgcatcgtca gcatcccatt tgcatacgag tgcctcccaa ccatactcct cttttgtgaa tcactacaat agtccagcca tgtactctgc cagctcttct gttgcgtctc agggatttcc ctctacttgt ggtcattatg ctatgtcaac tgtttctaat gccgcgtatc ctagtgtttc atatccctct ctgcctgctg gtgatacata tgggcaaatg tttacctcac agaatgctcc gactgttagg ccagttaaag ataattcatt ctctggtcaa aatacagcta tcagccatcc atcgccactt ccacctctac catcacaaca gcaccaccag cagcaaagtc tttcaggata cagtactcta acgtggtcat ctccaggcct tccatcgact caagacaatc tcatccgaaa ccacacagga tccctggctg tagcgaacaa caacccaacc attactgttg cagattcttt atcctgtcct gttatgcaaa atgttcagcc tcccaagtcc agcccagtgg tatccactgt tttatcagga tcctcaggat cctcatcaac aagaacacct cccactgcaa atcacccagt tgagcctgtg acctcagtta cacagccatc agagctatta caacaaaaag gtgttgacag ctcttctacc acaagcagtg cttctccaat gcccaacagt tatgatgccc tggaaggagg cagttaccca gatatgcttt cttcatcagc aagcagtcct gctcctgatc ccgcccctga acctgatcct gcttctgctc cagctccagc ttcagctcca gctcctgtcg tccctcagcc ttcaaaaatg gctaagcctt ttggctatgg ctatccaaca cttcagcctg gttatcagaa tgctacagca ccacttattt ctggagtaca gcccagtaac ccggtatatt ctggattcca gcagtatcct caacagtatc ctggtgtgaa ccagctatcc tccagtatag gaggattgag tcttcagagt tctccacaac cagaaagcct gagacctgta aaccttactc aggagaggaa tattttacct atgactcctg tttgggctcc tgtacctaac ttgaatgcag acctcaaaaa attaaactgt agcccagatt catttcggtg tactttgaca aatattccac agacacaggc tttactgaat aaagctaagc ttcctttagg attgttgtta catcccttca gagacctaac gcaattacca gtgataacat caaataccat tgtgaggtgc cgatcctgtc gaacgtatat taaccccttt gtatccttca ttgatcaacg tagatggaaa tgcaatttgt gctatagagt aaacgatgtt cctgaagaat ttatgtataa cccccttacc cgatcttatg gagagcctca taaacgacca gaagttcaga attcaactgt ggagttcatt gcttcttcag attacatgct gcgtcctcct caacctgcag tttacttgtt tgttttagat gtgtctcata atgcagtgga agctggatat ttgacaattt tgtgccagtc actcctagaa aatctagaca agcttcctgg agattcacga acaagaatag gattcatgac ctttgatagc actattcatt tctacaattt acaagaagga ttatcacagc ctcaaatgtt gattgtgtct gatatagatg atgtttttct acctacaccg gatagtttac ttgtgaatct atatgaaagt aaagagctta taaaagactt actgaatgca ttaccaaaca tgttcaccaa tacaagagaa acacacagtg cccttggtcc tgcacttcag gctgccttta aattaatgtc tccaacaggt ggccgtgtgt ctgtatttca gacacagtta ccttccttgg gtgcaggact tctgcaatcc agagaagatc ctaatcagag atcaagtaca aaggtggtac aacatcttgg ccctgcaact gatttttata agaaacttgc attagattgc tcgggacagc aaactgcagt ggatttgttc cttttaagtt cacagtattc tgatcttgct tctctagctt gcatgtccaa gtattctgca gggtgcatct attattatcc atcattccac tatactcaca atccttcaca agcagaaaag ttacaaaaag acctaaaacg gtatctcaca agaaaaattg ggtttgaagc tgttatgaga ataaggtgta ctaaaggtct ttcaatgcac acttttcacg gtaacttctt tgtccgttct actgatttgt tatcccttgc caacatcaat cctgatgctg gatttgcggt gcagttgtca attgaagaaa gtttaacaga tacttcctta gtatgttttc aaacagccct attatataca tcaagcaaag gtgagcggag aattagagta catacacttt gtttgccagt ggtaagttca ctagcagatg tatatgcggg agtggatgta caagctgcca tctgccttct ggcaaacatg gctgtggatc ggtccgtttc atcaagtctg tcagatgcaa gagatgcctt agtgaatgct gtagtggact cattgtctgc atatggctca actgtctcaa atttacagca ctctgcattg atggcgccca gctccctcaa gttgtttcct ctctatgttt tggcccttct caaacagaaa gcatttagaa cgggtacaag cacacggctg gatgatcgtg tatatgccat gtgtcagata aagtctcagc cacttgttca tctaatgaaa atgattcatc ccaacttata caggatagac agattgacag atgagggtgc agtacatgtt aatgacagga ttgtaccaca gccacctctt caaaaattgt ctgcagagaa gctgacaaga gaaggtgctt tccttatgga ctgtggctct gttttttaca tttgggttgg gaaaggctgt gacaataact tcatagagga tgtgcttgga tatactaatt ttgcatcaat accacagaaa atgacacatc ttccagagct agatacactt tcatcagaaa gagccagatc cttcataact tggcttagag acagcagacc attaagtcca atccttcaca tagtaaaaga tgagagtcct gccaaagcag aattttttca gcatttgatt gaagaccgga cagaggctgc attttcttac tatgaatttt tgcttcatgt tcagcagcag atttgtaagt ga. It is sometimes possible for the material contained within the vial of "SEC24B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.