Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLIPR1L2 cdna clone

GLIPR1L2 cDNA Clone

Synonyms
GLIPR1L2; GLIPR1L2 cDNA Clone; GLIPR1L2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccgcaaggcccttcgcccgggagtggagggcccagtccctacccctggcagtagggggcgttttgaagctgcggctctgtgagctgtggctactgctactgggttctagtttgaacgccagatttttgccagacgaggaggacgtagactttatcaacgagtacgtgaacctccacaatgagctgcggggcgacgtcattccccgagggtctaacttgcgcttcatgacttgggatgtagctttatcacggactgctagagcatggggaaaaaaatgtttgtttacgcataatatttatttacaagatgtacaaatggtccatcctaaattttatggtattggtgaaaatatgtgggtcggccctgaaaatgaatttactgcaagtattgctatcagaagttggcatgcagagaagaaaatgtacaattttgaaaatggcagttgctctggagactgttctaattatattcagcttgtttgggaccactcttacaaagttggttgtgctgttactccatgttcaaaaattggacatattatacatgcagcaattttcatatgcaactatgcgccaggaggaacactgacgagaagaccttatgaaccaggaatattttgtactcgatgtggcagacgtgacaaatgcacagattttctatgcagtaagataaagaaaataaacatgaaaaaaatgcataatggattggacaagaaaaataagcgattgaacactagttttttatggtcatgttaa
Sequence Length
762
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,810 Da
NCBI Official Full Name
Homo sapiens GLI pathogenesis-related 1 like 2, mRNA
NCBI Official Synonym Full Names
GLI pathogenesis-related 1 like 2
NCBI Official Symbol
GLIPR1L2
NCBI Protein Information
GLIPR1-like protein 2
UniProt Protein Name
GLIPR1-like protein 2
Protein Family
UniProt Gene Name
GLIPR1L2
UniProt Entry Name
GRPL2_HUMAN

NCBI Description

This gene encodes a member of the cysteine-rich secretory protein, antigen 5, and pathogenesis-related 1 superfamily. Members of this family have roles in a variety of processes, including cancer and immune defense. This gene is located in a cluster with two related genes on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Uniprot Description

GLIPR1L2: a member of the cysteine-rich secretory protein, antigen 5, and pathogenesis-related 1 superfamily. Members of this family have roles in a variety of processes, including cancer and immune defense. This gene is located in a cluster with two related genes on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q21.2

Similar Products

Product Notes

The GLIPR1L2 glipr1l2 (Catalog #AAA1276129) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccg caaggccctt cgcccgggag tggagggccc agtccctacc cctggcagta gggggcgttt tgaagctgcg gctctgtgag ctgtggctac tgctactggg ttctagtttg aacgccagat ttttgccaga cgaggaggac gtagacttta tcaacgagta cgtgaacctc cacaatgagc tgcggggcga cgtcattccc cgagggtcta acttgcgctt catgacttgg gatgtagctt tatcacggac tgctagagca tggggaaaaa aatgtttgtt tacgcataat atttatttac aagatgtaca aatggtccat cctaaatttt atggtattgg tgaaaatatg tgggtcggcc ctgaaaatga atttactgca agtattgcta tcagaagttg gcatgcagag aagaaaatgt acaattttga aaatggcagt tgctctggag actgttctaa ttatattcag cttgtttggg accactctta caaagttggt tgtgctgtta ctccatgttc aaaaattgga catattatac atgcagcaat tttcatatgc aactatgcgc caggaggaac actgacgaga agaccttatg aaccaggaat attttgtact cgatgtggca gacgtgacaa atgcacagat tttctatgca gtaagataaa gaaaataaac atgaaaaaaa tgcataatgg attggacaag aaaaataagc gattgaacac tagtttttta tggtcatgtt aa. It is sometimes possible for the material contained within the vial of "GLIPR1L2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.