Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUBPL cdna clone

NUBPL cDNA Clone

Gene Names
NUBPL; IND1; huInd1; C14orf127
Synonyms
NUBPL; NUBPL cDNA Clone; NUBPL cdna clone
Ordering
For Research Use Only!
Sequence
atggtttgtgggcgccagttgtctggcgccgggagtgagaccctaaaacaaagaagaacacaaatcatgtcccgaggacttccaaagcagaaaccgatagaaggtgttaaacaagttatagttgtggcttctggaaagggtggagtcggaaaatctactacagcagtgaatcttgcacttgcactagcagcgaacgattcgtccaaggccattggtttgctagatgtggatgtgtatggaccttcagttccaaagatgatgaatctgaaaggaaatccggaattatcacagagcaacctaatgaggcctctcttgaattatggtattgcttgtatgtctatgggctttctggttgaagaaagtgaaccagtagtttggagaggccttatggtaatgtcggccattgagaaattgttgaggcaggtagattggggtcaactggactacttagttgtagacatgccaccaggaactggagatgtgcagttatcagtctcacagactattcctataacaggtgctgtgattgtctccacgccccaggacatcgcattgatggatgcacacaagggtgctgagatgtttcgcagagtccacgtgcccgtccttggccttgtccaaaacatgagtgttttccagtgtccaaaatgtaaacacaaaactcatatttttggtgctgatggtgcaaggaaactagcacagacccttggtcttgaagttctaggagacattcccttacaccttaatataagggaagcttcagatacaggccagccaattgtgttttcacagcctgaaagtgatgaggccaaagcttacttgaggattgctgtggaagtggtaagaagattgccatcaccttcagaatga
Sequence Length
870
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,209 Da
NCBI Official Full Name
Homo sapiens nucleotide binding protein-like, mRNA
NCBI Official Synonym Full Names
nucleotide binding protein like
NCBI Official Symbol
NUBPL
NCBI Official Synonym Symbols
IND1; huInd1; C14orf127
NCBI Protein Information
iron-sulfur protein NUBPL
UniProt Protein Name
Iron-sulfur protein NUBPL
Protein Family
UniProt Gene Name
NUBPL
UniProt Synonym Gene Names
C14orf127
UniProt Entry Name
NUBPL_HUMAN

NCBI Description

This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Uniprot Description

NUBPL: Required for the assembly of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I). May deliver of one or more Fe-S clusters to complex I subunits. Defects in NUBPL are a cause of mitochondrial complex I deficiency (MT-C1D). A disorder of the mitochondrial respiratory chain that causes a wide range of clinical manifestations from lethal neonatal disease to adult-onset neurodegenerative disorders. Phenotypes include macrocephaly with progressive leukodystrophy, non-specific encephalopathy, cardiomyopathy, myopathy, liver disease, Leigh syndrome, Leber hereditary optic neuropathy, and some forms of Parkinson disease. Belongs to the Mrp/NBP35 ATP-binding proteins family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 14q12

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: 4 iron, 4 sulfur cluster binding

Biological Process: mitochondrial respiratory chain complex I assembly

Disease: Mitochondrial Complex I Deficiency

Research Articles on NUBPL

Similar Products

Product Notes

The NUBPL nubpl (Catalog #AAA1276082) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtttgtg ggcgccagtt gtctggcgcc gggagtgaga ccctaaaaca aagaagaaca caaatcatgt cccgaggact tccaaagcag aaaccgatag aaggtgttaa acaagttata gttgtggctt ctggaaaggg tggagtcgga aaatctacta cagcagtgaa tcttgcactt gcactagcag cgaacgattc gtccaaggcc attggtttgc tagatgtgga tgtgtatgga ccttcagttc caaagatgat gaatctgaaa ggaaatccgg aattatcaca gagcaaccta atgaggcctc tcttgaatta tggtattgct tgtatgtcta tgggctttct ggttgaagaa agtgaaccag tagtttggag aggccttatg gtaatgtcgg ccattgagaa attgttgagg caggtagatt ggggtcaact ggactactta gttgtagaca tgccaccagg aactggagat gtgcagttat cagtctcaca gactattcct ataacaggtg ctgtgattgt ctccacgccc caggacatcg cattgatgga tgcacacaag ggtgctgaga tgtttcgcag agtccacgtg cccgtccttg gccttgtcca aaacatgagt gttttccagt gtccaaaatg taaacacaaa actcatattt ttggtgctga tggtgcaagg aaactagcac agacccttgg tcttgaagtt ctaggagaca ttcccttaca ccttaatata agggaagctt cagatacagg ccagccaatt gtgttttcac agcctgaaag tgatgaggcc aaagcttact tgaggattgc tgtggaagtg gtaagaagat tgccatcacc ttcagaatga. It is sometimes possible for the material contained within the vial of "NUBPL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.