MOXD1 cdna clone
MOXD1 cDNA Clone
Gene Names
MOXD1; MOX; PRO5780; dJ248E1.1
Synonyms
MOXD1; MOXD1 cDNA Clone; MOXD1 cdna clone
Sequence
atgtgctgctggccgctgctcctgctgtgggggctgctccccgggacggcggcggggggctcgggccgaacctatccgcaccggaccctcctggactcggagggcaagtactggctgggctggagccagcggggcagccagatcgccttccgcctccaggtgcgcactgcaggctacgtgggcttcggcttctcgcccaccggggccatggcgtccgccgacatcgtcgtgggcggggtggcccacgggcggccctacctccaggattattttacaaatgcaaatagagagttgaaaaaagatgctcagcaagattaccatctagaatatgccatggaaaatagcacacacacaataattgaatttaccagagagctgcatacatgtgacataaatgacaagagtataacggatagcactgtgagagtgatctgggcctaccaccatgaagatgcaggagaagctggtcccaagtaccatgactccaataggggcaccaagagtttgcggttattgaatcctgagaaaactagtgtgctatctacagccttaccatactttgatctggtaaatcaggacgtccccatcccaaacaaagatacaacatattggtgccaaatgtttaagattcctgtgttccaagaaaagcatcatgtaataaaggttgagccagtgatacagagaggccatgagagtctggtgcaccacatcctgctctatcagtgcagcaacaactttaacgacagcgttctggagtccggccacgagtgctatcaccccaacatgcccgatgcattcctcacctgtgaaactgtgatttttgcctgggctattggtggagagggcttttcttatccacctcatgttggattatcccttggcactccattagatccgcattatgtgctcctagaagtccattatgataatcccacttatgaggaaggcttaatagataattctggactgaggttattttacacaatggatataaggaaatatgatgctggggtgattgaggctggcctctgggtgagcctcttccataccatccctccagggatgcctgagttccagtctgagggtcactgcactttggagtgcctggaagaggctctggaagccgaaaagccaagtggaattcatgtgtttgctgttcttctccatgctcacctggctggcagaggcatcaggctgcgtcattttcgaaaagggaaggaaatgaaattacttgcctatgatgatgattttgacttcaatttccaggagtttcagtatctaaaggaagaacaaacaatcttaccaggagataacctaattactgagtgtcgctacaacacgaaagatagagctgagatgacttggggaggactaagcaccaggagtgaaatgtgtctctcataccttctttattacccaagaattaatcttactcgatgtgcaagtattccagacattatggaacaacttcagttcattggggttaaggagatctacagaccagtcacgacctggcctttcattatcaaaagtcccaagcaatataaaaacctttctttcatggatgctatgaataagtttaaatggactaaaaaggaaggtctctccttcaacgagctggtcctcagcctgccagtgaatgtgagatgttccaagacagacaatgctgagtggtcgattcaaggaatgacagcattacctccagatatagaaagaccctataaagcagaacctttggtgtgtggcacgtcttcttcctcttccctgcacagagatttctccatcaacttgcttgtttgccttctgctactcagctgcacgctgagcaccaagagcttgtga
Sequence Length
1842
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,700 Da
NCBI Official Full Name
Homo sapiens monooxygenase, DBH-like 1, mRNA
NCBI Official Synonym Full Names
monooxygenase DBH like 1
NCBI Official Symbol
MOXD1
NCBI Official Synonym Symbols
MOX; PRO5780; dJ248E1.1
NCBI Protein Information
DBH-like monooxygenase protein 1
UniProt Protein Name
DBH-like monooxygenase protein 1
Protein Family
UniProt Gene Name
MOXD1
UniProt Synonym Gene Names
MOX
UniProt Entry Name
MOXD1_HUMAN
Uniprot Description
MOXD1: Belongs to the copper type II ascorbate-dependent monooxygenase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 1.14.17.-; Membrane protein, integral; Oxidoreductase
Chromosomal Location of Human Ortholog: 6q23.2
Cellular Component: endoplasmic reticulum membrane
Molecular Function: protein binding
Research Articles on MOXD1
Similar Products
Product Notes
The MOXD1 moxd1 (Catalog #AAA1275872) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgctgct ggccgctgct cctgctgtgg gggctgctcc ccgggacggc ggcggggggc tcgggccgaa cctatccgca ccggaccctc ctggactcgg agggcaagta ctggctgggc tggagccagc ggggcagcca gatcgccttc cgcctccagg tgcgcactgc aggctacgtg ggcttcggct tctcgcccac cggggccatg gcgtccgccg acatcgtcgt gggcggggtg gcccacgggc ggccctacct ccaggattat tttacaaatg caaatagaga gttgaaaaaa gatgctcagc aagattacca tctagaatat gccatggaaa atagcacaca cacaataatt gaatttacca gagagctgca tacatgtgac ataaatgaca agagtataac ggatagcact gtgagagtga tctgggccta ccaccatgaa gatgcaggag aagctggtcc caagtaccat gactccaata ggggcaccaa gagtttgcgg ttattgaatc ctgagaaaac tagtgtgcta tctacagcct taccatactt tgatctggta aatcaggacg tccccatccc aaacaaagat acaacatatt ggtgccaaat gtttaagatt cctgtgttcc aagaaaagca tcatgtaata aaggttgagc cagtgataca gagaggccat gagagtctgg tgcaccacat cctgctctat cagtgcagca acaactttaa cgacagcgtt ctggagtccg gccacgagtg ctatcacccc aacatgcccg atgcattcct cacctgtgaa actgtgattt ttgcctgggc tattggtgga gagggctttt cttatccacc tcatgttgga ttatcccttg gcactccatt agatccgcat tatgtgctcc tagaagtcca ttatgataat cccacttatg aggaaggctt aatagataat tctggactga ggttatttta cacaatggat ataaggaaat atgatgctgg ggtgattgag gctggcctct gggtgagcct cttccatacc atccctccag ggatgcctga gttccagtct gagggtcact gcactttgga gtgcctggaa gaggctctgg aagccgaaaa gccaagtgga attcatgtgt ttgctgttct tctccatgct cacctggctg gcagaggcat caggctgcgt cattttcgaa aagggaagga aatgaaatta cttgcctatg atgatgattt tgacttcaat ttccaggagt ttcagtatct aaaggaagaa caaacaatct taccaggaga taacctaatt actgagtgtc gctacaacac gaaagataga gctgagatga cttggggagg actaagcacc aggagtgaaa tgtgtctctc ataccttctt tattacccaa gaattaatct tactcgatgt gcaagtattc cagacattat ggaacaactt cagttcattg gggttaagga gatctacaga ccagtcacga cctggccttt cattatcaaa agtcccaagc aatataaaaa cctttctttc atggatgcta tgaataagtt taaatggact aaaaaggaag gtctctcctt caacgagctg gtcctcagcc tgccagtgaa tgtgagatgt tccaagacag acaatgctga gtggtcgatt caaggaatga cagcattacc tccagatata gaaagaccct ataaagcaga acctttggtg tgtggcacgt cttcttcctc ttccctgcac agagatttct ccatcaactt gcttgtttgc cttctgctac tcagctgcac gctgagcacc aagagcttgt ga. It is sometimes possible for the material contained within the vial of "MOXD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
