Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2C2 cdna clone

EIF2C2 cDNA Clone

Gene Names
AGO2; Q10; EIF2C2
Synonyms
EIF2C2; EIF2C2 cDNA Clone; EIF2C2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaggaagtaccgtgtctgcaatgtgacccggcggcccgccagtcaccaaacattcccgctgcagcaggagagcgggcagacggtggagtgcacggtggcccagtatttcaaggacaggcacaagttggttctgcgctacccccacctcccatgtttacaagtcggacaggagcagaaacacacctaccttcccctggaggtctgtaacattgtggcaggacaaagatgtattaaaaaattaacggacaatcagacctcaaccatgatcagagcaactgctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgcaagtttcaacacagatccatacgtccgtgaatttggaatcatggtcaaagatgagatgacagacgtgactgggcgggtgctgcagccgccctccatcctctacgggggcaggaataaagctattgcgacccctgtccagggcgtctgggacatgcggaacaagcagttccacacgggcatcgagatcaaggtgtgggccattgcgtgcttcgccccccagcgccagtgcacggaagtccatctgaagtccttcacagagcagctcagaaagatctcgagagacgctggcatgcccatccagggccagccgtgcttctgcaaatacgcgcagggggcggacagcgtggagcccatgttccggcacctgaagaacacgtatgcgggcctgcagctggtggtggtcatcctgcccggcaagacgcccgtgtacgccgaggtcaagcgcgtgggagacacggtgctggggatggccacgcagtgcgtgcagatgaagaacgtgcagaggaccacgccacagaccctgtccaacctctgcctgaagatcaacgtcaagctgggaggcgtgaacaacatcctgctgccccagggcaggccgccggtgttccagcagcccgtcatctttctgggagcagacgtcactcacccccccgccggggatgggaagaagccctccattgccgccgtggtgggcagcatggacgcccaccccaatcgctactgcgccaccgtgcgcgtgcagcagcaccggcaggagatcatacaagacctggccgccatggtccgcgagctcctcatccagttctacaagtccacgcgcttcaagcccacccgcatcatcttctaccgcgacggtgtctctgaaggccagttccagcaggttctccaccacgagttgctggccatccgtgaggcctgtatcaagctagaaaaagactaccagcccgggatcaccttcatcgtggtgcagaagaggcaccacacccggctcttctgcactgacaagaacgagcgggttgggaaaagtggaaacattccagcaggcacgactgtggacacgaaaatcacccaccccaccgagttcgacttctacctgtgtagtcacgctggcatccaggggacaagcaggccttcgcactatcacgtcctctgggacgacaatcgtttctcctctgatgagctgcagatcctaacctaccagctgtgtcacacctacgtgcgctgcacacgctccgtgtccatcccagcgccagcatactacgctcacctggtggccttccgggccaggtaccacctggtggataaggaacatgacagtgctgaaggaagccatacctctgggcagagtaacgggcgagaccaccaagcactggccaaggcggtccaggttcaccaagacactctgcgcaccatgtactttgcttga
Sequence Length
1758
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,620 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2C, 2, mRNA
NCBI Official Synonym Full Names
argonaute 2, RISC catalytic component
NCBI Official Symbol
AGO2
NCBI Official Synonym Symbols
Q10; EIF2C2
NCBI Protein Information
protein argonaute-2
UniProt Protein Name
Protein argonaute-2
UniProt Gene Name
AGO2
UniProt Synonym Gene Names
EIF2C2; Argonaute2; hAgo2; eIF-2C 2; eIF2C 2; PPD
UniProt Entry Name
AGO2_HUMAN

NCBI Description

This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

AGO2: the endonuclease in RNA-induced silencing complexes (RISC) that cleaves siRNA/mRNA heteroduplexes bound to RISC. Ago2, along with Dicer and TRBP, are major components of RISC. Interacts with Dicer1 through its Piwi domain. Required for proper fibroblast growth factor signaling during gastrulation. Essential for embryonic development as well as RNA-mediated gene silencing (RNAi).

Protein type: RNA-binding; EC 3.1.26.n2; RNA processing

Chromosomal Location of Human Ortholog: 8q24

Cellular Component: cytoplasm; cytosol; membrane; mRNA cap complex; nucleoplasm; nucleus; polysome; ribonucleoprotein complex

Molecular Function: double-stranded RNA binding; endoribonuclease activity; miRNA binding; protein binding; protein C-terminus binding; RNA 7-methylguanosine cap binding; single-stranded RNA binding; siRNA binding

Biological Process: miRNA-mediated gene silencing, miRNA loading onto RISC; miRNA-mediated gene silencing, mRNA cleavage; miRNA-mediated gene silencing, negative regulation of translation; miRNA-mediated gene silencing, production of miRNAs; negative regulation of translational initiation; phosphoinositide-mediated signaling; positive regulation of transcription from RNA polymerase II promoter; pre-microRNA processing; RNA interference, siRNA loading onto RISC; RNA secondary structure unwinding; RNA-mediated gene silencing; RNA-mediated posttranscriptional gene silencing; Wnt receptor signaling pathway, calcium modulating pathway

Research Articles on EIF2C2

Similar Products

Product Notes

The EIF2C2 ago2 (Catalog #AAA1275868) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagagga agtaccgtgt ctgcaatgtg acccggcggc ccgccagtca ccaaacattc ccgctgcagc aggagagcgg gcagacggtg gagtgcacgg tggcccagta tttcaaggac aggcacaagt tggttctgcg ctacccccac ctcccatgtt tacaagtcgg acaggagcag aaacacacct accttcccct ggaggtctgt aacattgtgg caggacaaag atgtattaaa aaattaacgg acaatcagac ctcaaccatg atcagagcaa ctgctaggtc ggcgcccgat cggcaagaag agattagcaa attgatgcga agtgcaagtt tcaacacaga tccatacgtc cgtgaatttg gaatcatggt caaagatgag atgacagacg tgactgggcg ggtgctgcag ccgccctcca tcctctacgg gggcaggaat aaagctattg cgacccctgt ccagggcgtc tgggacatgc ggaacaagca gttccacacg ggcatcgaga tcaaggtgtg ggccattgcg tgcttcgccc cccagcgcca gtgcacggaa gtccatctga agtccttcac agagcagctc agaaagatct cgagagacgc tggcatgccc atccagggcc agccgtgctt ctgcaaatac gcgcaggggg cggacagcgt ggagcccatg ttccggcacc tgaagaacac gtatgcgggc ctgcagctgg tggtggtcat cctgcccggc aagacgcccg tgtacgccga ggtcaagcgc gtgggagaca cggtgctggg gatggccacg cagtgcgtgc agatgaagaa cgtgcagagg accacgccac agaccctgtc caacctctgc ctgaagatca acgtcaagct gggaggcgtg aacaacatcc tgctgcccca gggcaggccg ccggtgttcc agcagcccgt catctttctg ggagcagacg tcactcaccc ccccgccggg gatgggaaga agccctccat tgccgccgtg gtgggcagca tggacgccca ccccaatcgc tactgcgcca ccgtgcgcgt gcagcagcac cggcaggaga tcatacaaga cctggccgcc atggtccgcg agctcctcat ccagttctac aagtccacgc gcttcaagcc cacccgcatc atcttctacc gcgacggtgt ctctgaaggc cagttccagc aggttctcca ccacgagttg ctggccatcc gtgaggcctg tatcaagcta gaaaaagact accagcccgg gatcaccttc atcgtggtgc agaagaggca ccacacccgg ctcttctgca ctgacaagaa cgagcgggtt gggaaaagtg gaaacattcc agcaggcacg actgtggaca cgaaaatcac ccaccccacc gagttcgact tctacctgtg tagtcacgct ggcatccagg ggacaagcag gccttcgcac tatcacgtcc tctgggacga caatcgtttc tcctctgatg agctgcagat cctaacctac cagctgtgtc acacctacgt gcgctgcaca cgctccgtgt ccatcccagc gccagcatac tacgctcacc tggtggcctt ccgggccagg taccacctgg tggataagga acatgacagt gctgaaggaa gccatacctc tgggcagagt aacgggcgag accaccaagc actggccaag gcggtccagg ttcaccaaga cactctgcgc accatgtact ttgcttga. It is sometimes possible for the material contained within the vial of "EIF2C2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.