GPR37 cdna clone
GPR37 cDNA Clone
Gene Names
GPR37; PAELR; EDNRBL; hET(B)R-LP
Synonyms
GPR37; GPR37 cDNA Clone; GPR37 cdna clone
Sequence
atgcgagccccgggcgcgcttctcgcccgcatgtcgcggctactgcttctgctactgctcaaggtgtctgcctcttctgccctcggggtcgcccctgcgtccagaaacgaaacttgtctgggggagagctgtgcacctacagtgatccagcgccgcggcagggacgcctggggaccgggaaattctgcaagagacgttctgcgagcccgagcacccagggaggagcagggggcagcgtttcttgcgggaccctcctgggacctgccggcggccccgggccgtgacccggctgcaggcagaggggcggaggcgtcggcagccggacccccgggacctccaaccaggccacctggcccctggaggtggaaaggtgctcggggtcaggagccttctgaaactttggggagagggaaccccacggccctccagctcttccttcagatctcagaggaggaagagaagggtcccagaggcgctggcatttccgggcgtagccaggagcagagtgtgaagacagtccccggagccagcgatcttttttactggccaaggagagccgggaaactccagggttcccaccacaagcccctgtccaagacggccaatggactggcggggcacgaagggtggacaattgcactcccgggccgggcgctggcccagaatggatccttgggtgaaggaatccatgagcctgggggtccccgccggggaaacagcacgaaccggcgtgtgagactgaagaaccccttctacccgctgacccaggagtcctatggagcctacgcggtcatgtgtctgtccgtggtgatcttcgggaccggcatcattggcaacctggcggtgatgtgcatcgtgtgccacaactactacatgcggagcatctccaactccctcttggccaacctggccttctgggactttctcatcatcttcttctgccttccgctggtcatcttccacgagctgaccaagaagtggctgctggaggacttctcctgcaagatcgtgccctatatagaggtcgcttctctgggagtcaccaccttcaccttatgtgctctgtgcatagaccgcttccgtgctgccaccaacgtacagatgtactacgaaatgatcgaaaactgttcctcaacaactgccaaacttgctgttatatgggtgggagctctattgttagcacttccagaagttgttctccgccagctgagcaaggaggatttggggtttagtggccgagctccggcagaaaggtgcattattaagatctctcctgatttaccagacaccatctatgttctagccctcacctacgacagtgcgagactgtggtggtattttggctgttacttttgtttgcccacgcttttcaccatcacctgctctctagtgactgcgaggaaaatccgcaaagcagagaaagcctgtacccgagggaataaacggcagattcaactagagagtcagatgaactgtacagtagtggcactgaccattttatatggattttgcattattcctgaaaatatctgcaacattgttactgcctacatggctacaggggtttcacagcagacaatggacctccttaatatcatcagccagttccttttgttctttaagtcctgtgtcaccccagtcctccttttctgtctctgcaaacccttcagtcgggccttcatggagtgctgctgctgttgctgtgaggaatgcattcagaagtcttcaacggtgaccagtgatgacaatgacaacgagtacaccacggaactcgaactctcgcctttcagtaccatacgccgtgaaatgtccacttttgcttctgtcggaactcattgctga
Sequence Length
1842
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,114 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like), mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 37
NCBI Official Symbol
GPR37
NCBI Official Synonym Symbols
PAELR; EDNRBL; hET(B)R-LP
NCBI Protein Information
prosaposin receptor GPR37
UniProt Protein Name
Prosaposin receptor GPR37
Protein Family
UniProt Gene Name
GPR37
UniProt Synonym Gene Names
ETBR-LP-1; PAELR
UniProt Entry Name
GPR37_HUMAN
NCBI Description
This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
Uniprot Description
GPR37: Orphan receptor. May have a unique functional role in the central nervous system. Belongs to the G-protein coupled receptor 1 family.
Protein type: Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 1; Membrane protein, integral
Chromosomal Location of Human Ortholog: 7q31
Cellular Component: endoplasmic reticulum; integral to plasma membrane; plasma membrane; receptor complex; ubiquitin ligase complex
Molecular Function: G-protein coupled receptor activity; heat shock protein binding; Hsp70 protein binding; peptide binding; peptide receptor activity, G-protein coupled; protein binding; ubiquitin protein ligase binding
Biological Process: G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; positive regulation of MAPKKK cascade
Research Articles on GPR37
Similar Products
Product Notes
The GPR37 gpr37 (Catalog #AAA1275822) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgagccc cgggcgcgct tctcgcccgc atgtcgcggc tactgcttct gctactgctc aaggtgtctg cctcttctgc cctcggggtc gcccctgcgt ccagaaacga aacttgtctg ggggagagct gtgcacctac agtgatccag cgccgcggca gggacgcctg gggaccggga aattctgcaa gagacgttct gcgagcccga gcacccaggg aggagcaggg ggcagcgttt cttgcgggac cctcctggga cctgccggcg gccccgggcc gtgacccggc tgcaggcaga ggggcggagg cgtcggcagc cggacccccg ggacctccaa ccaggccacc tggcccctgg aggtggaaag gtgctcgggg tcaggagcct tctgaaactt tggggagagg gaaccccacg gccctccagc tcttccttca gatctcagag gaggaagaga agggtcccag aggcgctggc atttccgggc gtagccagga gcagagtgtg aagacagtcc ccggagccag cgatcttttt tactggccaa ggagagccgg gaaactccag ggttcccacc acaagcccct gtccaagacg gccaatggac tggcggggca cgaagggtgg acaattgcac tcccgggccg ggcgctggcc cagaatggat ccttgggtga aggaatccat gagcctgggg gtccccgccg gggaaacagc acgaaccggc gtgtgagact gaagaacccc ttctacccgc tgacccagga gtcctatgga gcctacgcgg tcatgtgtct gtccgtggtg atcttcggga ccggcatcat tggcaacctg gcggtgatgt gcatcgtgtg ccacaactac tacatgcgga gcatctccaa ctccctcttg gccaacctgg ccttctggga ctttctcatc atcttcttct gccttccgct ggtcatcttc cacgagctga ccaagaagtg gctgctggag gacttctcct gcaagatcgt gccctatata gaggtcgctt ctctgggagt caccaccttc accttatgtg ctctgtgcat agaccgcttc cgtgctgcca ccaacgtaca gatgtactac gaaatgatcg aaaactgttc ctcaacaact gccaaacttg ctgttatatg ggtgggagct ctattgttag cacttccaga agttgttctc cgccagctga gcaaggagga tttggggttt agtggccgag ctccggcaga aaggtgcatt attaagatct ctcctgattt accagacacc atctatgttc tagccctcac ctacgacagt gcgagactgt ggtggtattt tggctgttac ttttgtttgc ccacgctttt caccatcacc tgctctctag tgactgcgag gaaaatccgc aaagcagaga aagcctgtac ccgagggaat aaacggcaga ttcaactaga gagtcagatg aactgtacag tagtggcact gaccatttta tatggatttt gcattattcc tgaaaatatc tgcaacattg ttactgccta catggctaca ggggtttcac agcagacaat ggacctcctt aatatcatca gccagttcct tttgttcttt aagtcctgtg tcaccccagt cctccttttc tgtctctgca aacccttcag tcgggccttc atggagtgct gctgctgttg ctgtgaggaa tgcattcaga agtcttcaac ggtgaccagt gatgacaatg acaacgagta caccacggaa ctcgaactct cgcctttcag taccatacgc cgtgaaatgt ccacttttgc ttctgtcgga actcattgct ga. It is sometimes possible for the material contained within the vial of "GPR37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
