Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCTN1 cdna clone

DCTN1 cDNA Clone

Gene Names
DCTN1; P135; DP-150; DAP-150
Synonyms
DCTN1; DCTN1 cDNA Clone; DCTN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgagacaggcaccgacagcccgaaagaccacaactcggcgacccaagcccacgcgcccagccagtactggggtggctggggccagtagctccctgggcccctctggctcagcgtcagcaggtgagctgagcagcagtgagcccagcaccccggctcagactccgctggcagcacccatcatccccacgccggtcctcacctctcctggagcagtccccccgcttccttccccatccaaggaggaggagggactaagggctcaggtgcgggacctggaggagaaactagagaccctgagactgaaacgggcagaagacaaagcaaagctaaaagagctggagaaacacaaaatccagctggagcaggtgcaggaatggaagagcaaaatgcaggagcagcaggccgacctgcagcggcgcctcaaggaggcgagaaaggaagccaaggaggcgctggaggcaaaggaacgctatatggaggagatggctgatactgctgatgccattgagatggccactttggacaaggagatggctgaagagcgggctgagtccctgcagcaggaggtggaggcactgaaggagcgggtggacgagctcactactgacttagagatcctcaaggctgagattgaagagaagggctcagatggcgctgcatccagttatcagctcaagcagcttgaggagcagaatgcccgcctgaaggatgccctggtgaggatgcgggatctttcttcctcagagaagcaggagcatgtgaagctccagaagctcatggaaaagaagaaccaagagctggaagttgtgaggcaacagcgggagcgtctgcaggaggagctaagccaggcagagagcaccattgatgagctcaaggagcaggtggatgctgctctgggtgctgaggagatggtggagatgctgacagatcggaacctgaatctggaagagaaagtgcgcgagttgagggagactgtgggagacttggaagcgatgaatgagatgaacgatgagctgcaggagaatgcacgtgagacagaactggagctgcgggagcagctggacatggcaggcgcgcgggttcgtgaggcccagaagcgtgtggaggcagcccaggagacggttgcagactaccagcagaccatcaagaagtaccgccagctgaccgccaatctacaggatgtgaatcgggaactgacaaaccagcaggaagcatctgtggagaggcaacagcagccacctccagagacctttgacttcaaaatcaagtttgctgagactaaggcccatgccaaggcaattgagatggaattgaggcagatggaggtggcccaggccaatcgacacatgtccctgctgacagccttcatgcctgacagcttccttcggccaggtggggaccatgactgcgttctggtgctgttgctcatgcctcgtctcatttgcagggcagagctgatccggaagcaggcccaggagaagtttgaactaagtgagaactgttcagagcggcctgggctgcgaggagctgctggggagcaactcagctttgctgctggactggtgtactcgctgagcctgctgcaggccacgctacaccgctatgagcatgccctctctcagtgcagtgtggatgtgtataagaaagtgggcagcctgtaccctgagatgagtgcccatgagcgctccttggatttcctcattgaactgctgcacaaggatcagctggatgagactgtcaatgtggagcctctcaccaaggccatcaagtactatcagcatctgtacagcatccaccttgccgaacagcctgaggactgtactatgcagctggctgaccacattaagttcacgcagagtgctctggactgcatgagtgtggaggtaggacggctgcgtgccttcttgcagggtgggcaggaggctacagatattgccctcctgctccgggatctggaaacttcatgcagtgacatccgccagttctgcaagaagatccgaaggcgaatgccagggacagatgctcctgggatcccagctgcactggcctttggaccacaggtatctgacacgctcctagactgcaggaaacacttgacgtgggtcgtggctgtgctgcaggaggtggcagctgctgctgcccagctcattgccccactggcagagaatgaggggctacttgtggctgctctggaggaactggctttcaaagcaagcgagcagatctatgggaccccctccagcagcccctatgagtgtctgcgccagtcatgcaacatcctcatcagtaccatgaacaagctggccacagccatgcaggagggggagtatgatgcagagcggccccccagcaagcctccaccggttgaactgcgggctgctgcccttcgtgcagagatcacagatgctgaaggcctgggtttgaagctcgaagatcgagagacagttattaaggagttgaagaagtcactcaagattaagggagaggagctaagtgaggccaatgtgcggctgagcctcctggagaagaagttggacagtgctgccaaggatgcagatgagcgcatcgagaaagtccagactcggctggaggagacccaggcactgctgcgaaagaaggagaaagagtttgaggagacaatggatgcactccaggctgacatcgaccagctggaggcagagaaggcagaactaaagcagcgtctgaacagccagtccaaacgcacgattgagggactccggggccctcctccttcaggcattgctactctggtctctggcattgctggtggagccatccctgggcaggctccagggtctgtgccaggcccagggctggtgaaggactcaccactgctgcttcagcagatctctgccatgaggctgcacatctcccagctccagcatgagaacagcatcctcaagggagcccagatgaaggcatccttggcatccctgccccctctgcatgttgcaaagctatcccatgagggccctggcagtgagttaccagctggagcgctgtatcgtaagaccagccagctgctggagacattgaatcaattgagcacacacacgcacgtagtagacatcactcgcaccagccctgctgccaagagcccgtcggcccaacttatggagcaagtggctcagcttaagtccctgagtgacaccgtcgagaagctcaaggatgaggtcctcaaggagacagtatctcagcgccctggagccacagtacccactgactttgccaccttcccttcatcagccttcctcagggccaaggaggagcagcaggatgacacagtctacatgggcaaagtgaccttctcatgtgcggctggttttggacagcgacaccggctggtgctgacccaggagcagctgcaccagcttcacattcgcctcatctcctaa
Sequence Length
3420
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
140,887 Da
NCBI Official Full Name
Homo sapiens dynactin 1 (p150, glued homolog, Drosophila), mRNA
NCBI Official Synonym Full Names
dynactin subunit 1
NCBI Official Symbol
DCTN1
NCBI Official Synonym Symbols
P135; DP-150; DAP-150
NCBI Protein Information
dynactin subunit 1
UniProt Protein Name
Dynactin subunit 1
Protein Family
UniProt Gene Name
DCTN1
UniProt Synonym Gene Names
DP-150
UniProt Entry Name
DCTN1_HUMAN

NCBI Description

This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]

Uniprot Description

dynactin 1: Required for the cytoplasmic dynein-driven retrograde movement of vesicles and organelles along microtubules. Dynein- dynactin interaction is a key component of the mechanism of axonal transport of vesicles and organelles. Defects in DCTN1 are the cause of distal hereditary motor neuronopathy type 7B (HMN7B); also known as progressive lower motor neuron disease (PLMND). HMN7B is a neuromuscular disorder. Distal hereditary motor neuronopathies constitute a heterogeneous group of neuromuscular disorders caused by selective degeneration of motor neurons in the anterior horn of the spinal cord, without sensory deficit in the posterior horn. The overall clinical picture consists of a classical distal muscular atrophy syndrome in the legs without clinical sensory loss. The disease starts with weakness and wasting of distal muscles of the anterior tibial and peroneal compartments of the legs. Later on, weakness and atrophy may expand to the proximal muscles of the lower limbs and/or to the distal upper limbs. Defects in DCTN1 are a cause of susceptibility to amyotrophic lateral sclerosis (ALS). ALS is a neurodegenerative disorder affecting upper and lower motor neurons, and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology is likely to be multifactorial, involving both genetic and environmental factors. Defects in DCTN1 are the cause of Perry syndrome (PERRYS); also called parkinsonism with alveolar hypoventilation and mental depression. Perry syndrome is a neuropsychiatric disorder characterized by mental depression not responsive to antidepressant drugs or electroconvulsive therapy, sleep disturbances, exhaustion and marked weight loss. Parkinsonism develops later and respiratory failure occurred terminally. Belongs to the dynactin 150 kDa subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Motor; Microtubule-binding

Chromosomal Location of Human Ortholog: 2p13

Cellular Component: centrosome; cytoplasm; cytosol; kinetochore; membrane; microtubule; retromer complex; spindle pole

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; ER to Golgi vesicle-mediated transport; G2/M transition of mitotic cell cycle; retrograde transport, endosome to Golgi

Disease: Amyotrophic Lateral Sclerosis 1; Neuronopathy, Distal Hereditary Motor, Type Viib; Perry Syndrome

Research Articles on DCTN1

Similar Products

Product Notes

The DCTN1 dctn1 (Catalog #AAA1275691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgagac aggcaccgac agcccgaaag accacaactc ggcgacccaa gcccacgcgc ccagccagta ctggggtggc tggggccagt agctccctgg gcccctctgg ctcagcgtca gcaggtgagc tgagcagcag tgagcccagc accccggctc agactccgct ggcagcaccc atcatcccca cgccggtcct cacctctcct ggagcagtcc ccccgcttcc ttccccatcc aaggaggagg agggactaag ggctcaggtg cgggacctgg aggagaaact agagaccctg agactgaaac gggcagaaga caaagcaaag ctaaaagagc tggagaaaca caaaatccag ctggagcagg tgcaggaatg gaagagcaaa atgcaggagc agcaggccga cctgcagcgg cgcctcaagg aggcgagaaa ggaagccaag gaggcgctgg aggcaaagga acgctatatg gaggagatgg ctgatactgc tgatgccatt gagatggcca ctttggacaa ggagatggct gaagagcggg ctgagtccct gcagcaggag gtggaggcac tgaaggagcg ggtggacgag ctcactactg acttagagat cctcaaggct gagattgaag agaagggctc agatggcgct gcatccagtt atcagctcaa gcagcttgag gagcagaatg cccgcctgaa ggatgccctg gtgaggatgc gggatctttc ttcctcagag aagcaggagc atgtgaagct ccagaagctc atggaaaaga agaaccaaga gctggaagtt gtgaggcaac agcgggagcg tctgcaggag gagctaagcc aggcagagag caccattgat gagctcaagg agcaggtgga tgctgctctg ggtgctgagg agatggtgga gatgctgaca gatcggaacc tgaatctgga agagaaagtg cgcgagttga gggagactgt gggagacttg gaagcgatga atgagatgaa cgatgagctg caggagaatg cacgtgagac agaactggag ctgcgggagc agctggacat ggcaggcgcg cgggttcgtg aggcccagaa gcgtgtggag gcagcccagg agacggttgc agactaccag cagaccatca agaagtaccg ccagctgacc gccaatctac aggatgtgaa tcgggaactg acaaaccagc aggaagcatc tgtggagagg caacagcagc cacctccaga gacctttgac ttcaaaatca agtttgctga gactaaggcc catgccaagg caattgagat ggaattgagg cagatggagg tggcccaggc caatcgacac atgtccctgc tgacagcctt catgcctgac agcttccttc ggccaggtgg ggaccatgac tgcgttctgg tgctgttgct catgcctcgt ctcatttgca gggcagagct gatccggaag caggcccagg agaagtttga actaagtgag aactgttcag agcggcctgg gctgcgagga gctgctgggg agcaactcag ctttgctgct ggactggtgt actcgctgag cctgctgcag gccacgctac accgctatga gcatgccctc tctcagtgca gtgtggatgt gtataagaaa gtgggcagcc tgtaccctga gatgagtgcc catgagcgct ccttggattt cctcattgaa ctgctgcaca aggatcagct ggatgagact gtcaatgtgg agcctctcac caaggccatc aagtactatc agcatctgta cagcatccac cttgccgaac agcctgagga ctgtactatg cagctggctg accacattaa gttcacgcag agtgctctgg actgcatgag tgtggaggta ggacggctgc gtgccttctt gcagggtggg caggaggcta cagatattgc cctcctgctc cgggatctgg aaacttcatg cagtgacatc cgccagttct gcaagaagat ccgaaggcga atgccaggga cagatgctcc tgggatccca gctgcactgg cctttggacc acaggtatct gacacgctcc tagactgcag gaaacacttg acgtgggtcg tggctgtgct gcaggaggtg gcagctgctg ctgcccagct cattgcccca ctggcagaga atgaggggct acttgtggct gctctggagg aactggcttt caaagcaagc gagcagatct atgggacccc ctccagcagc ccctatgagt gtctgcgcca gtcatgcaac atcctcatca gtaccatgaa caagctggcc acagccatgc aggaggggga gtatgatgca gagcggcccc ccagcaagcc tccaccggtt gaactgcggg ctgctgccct tcgtgcagag atcacagatg ctgaaggcct gggtttgaag ctcgaagatc gagagacagt tattaaggag ttgaagaagt cactcaagat taagggagag gagctaagtg aggccaatgt gcggctgagc ctcctggaga agaagttgga cagtgctgcc aaggatgcag atgagcgcat cgagaaagtc cagactcggc tggaggagac ccaggcactg ctgcgaaaga aggagaaaga gtttgaggag acaatggatg cactccaggc tgacatcgac cagctggagg cagagaaggc agaactaaag cagcgtctga acagccagtc caaacgcacg attgagggac tccggggccc tcctccttca ggcattgcta ctctggtctc tggcattgct ggtggagcca tccctgggca ggctccaggg tctgtgccag gcccagggct ggtgaaggac tcaccactgc tgcttcagca gatctctgcc atgaggctgc acatctccca gctccagcat gagaacagca tcctcaaggg agcccagatg aaggcatcct tggcatccct gccccctctg catgttgcaa agctatccca tgagggccct ggcagtgagt taccagctgg agcgctgtat cgtaagacca gccagctgct ggagacattg aatcaattga gcacacacac gcacgtagta gacatcactc gcaccagccc tgctgccaag agcccgtcgg cccaacttat ggagcaagtg gctcagctta agtccctgag tgacaccgtc gagaagctca aggatgaggt cctcaaggag acagtatctc agcgccctgg agccacagta cccactgact ttgccacctt cccttcatca gccttcctca gggccaagga ggagcagcag gatgacacag tctacatggg caaagtgacc ttctcatgtg cggctggttt tggacagcga caccggctgg tgctgaccca ggagcagctg caccagcttc acattcgcct catctcctaa. It is sometimes possible for the material contained within the vial of "DCTN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.