POP5 cdna clone
POP5 cDNA Clone
Gene Names
POP5; RPP2; RPP20; hPop5; HSPC004
Synonyms
POP5; POP5 cDNA Clone; POP5 cdna clone
Sequence
atggtgcggttcaagcacaggtacctgctctgcgaactggtgtctgacgacccccgctgccgcctaagcctcgatgaccgagttctgagcagcctcgtacgggacacgatcgccagggtgcacggaactttcggcgcagccgcctgctccatcggcttcgcggttcgatatctcaatgcctatactggaatagtgctacttcgatgcagaaaagaattctatcagcttgtgtggtcagctcttcccttcatcacatacttggagaacaaaggacaccgttacccatgctttttcaacacattacatgtgggaggtacaataagaacatgtcagaagttcctaattcagtacaacaggagacagctgttgatcttgttgcagaactgcactgatgaaggagagcgggaagctatccagaagtctgtgacaagaagctgcttactagaggaggaggaggagtcaggtgaggaggctgcagaagcaatggagtga
Sequence Length
492
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
12,826 Da
NCBI Official Full Name
Homo sapiens processing of 5, ribonuclease P/MRP subunit (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
POP5 homolog, ribonuclease P/MRP subunit
NCBI Official Symbol
POP5
NCBI Official Synonym Symbols
RPP2; RPP20; hPop5; HSPC004
NCBI Protein Information
ribonuclease P/MRP protein subunit POP5
UniProt Protein Name
Ribonuclease P/MRP protein subunit POP5
Protein Family
UniProt Gene Name
POP5
UniProt Synonym Gene Names
hPop5
UniProt Entry Name
POP5_HUMAN
Uniprot Description
POP5: Component of ribonuclease P, a protein complex that generates mature tRNA molecules by cleaving their 5'-ends. Also a component of RNase MRP. Belongs to the eukaryotic/archaeal RNase P protein component 2 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus; EC 3.1.26.5; Ribonuclease; RNA processing
Chromosomal Location of Human Ortholog: 12q24.31
Cellular Component: nucleoplasm
Molecular Function: protein binding
Biological Process: protein lipoylation; tRNA 5'-leader removal
Research Articles on POP5
Similar Products
Product Notes
The POP5 pop5 (Catalog #AAA1275690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcggt tcaagcacag gtacctgctc tgcgaactgg tgtctgacga cccccgctgc cgcctaagcc tcgatgaccg agttctgagc agcctcgtac gggacacgat cgccagggtg cacggaactt tcggcgcagc cgcctgctcc atcggcttcg cggttcgata tctcaatgcc tatactggaa tagtgctact tcgatgcaga aaagaattct atcagcttgt gtggtcagct cttcccttca tcacatactt ggagaacaaa ggacaccgtt acccatgctt tttcaacaca ttacatgtgg gaggtacaat aagaacatgt cagaagttcc taattcagta caacaggaga cagctgttga tcttgttgca gaactgcact gatgaaggag agcgggaagc tatccagaag tctgtgacaa gaagctgctt actagaggag gaggaggagt caggtgagga ggctgcagaa gcaatggagt ga. It is sometimes possible for the material contained within the vial of "POP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
