CDCA3 cdna clone
CDCA3 cDNA Clone
Gene Names
CDCA3; GRCC8; TOME-1
Synonyms
CDCA3; CDCA3 cDNA Clone; CDCA3 cdna clone
Sequence
atgggctcagccaagagcgtcccagtcacaccagcgcggcctccgccgcacaacaagcatctggctcgagtggcggacccccgttcacctagtgctggcatcctgcgcactcccatccaggtggagagctctccacagccaggcctaccagcaggggagcaactggagggtcttaaacatgcccaggactcagatccccgctctcctactcttggtattgcacggacacctatgaagaccagcagtggagaccccccaagcccactggtgaaacagctgagtgaagtatttgaaactgaagactctaaatcaaatcttcccccagagcctgttctgcccccagaggcacctttatcttctgaattggacttgcctctgggtacccagttatctgttgaggaacagatgccaccttggaaccagactgagttcccctccaaacaggtgttttccaaggaggaagcaagacagcccacagaaacccctgtggccagccagagctccgacaagccctcaagggaccctgagactcccagatcttcaggttctatgcgcaatagatggaaaccaaacagcagcaaggtactagggagatcccccctcaccatcctgcaggatgacaactcccctggcaccctgacactacgacagggtaagcggccttcacccctaagtgaaaatgttagtgaactaaaggaaggagccattcttggaactggacgacttctgaaaactggaggacgagcatgggagcaaggccaggaccatgacaaggaaaatcagcactttcccttggtggagagctag
Sequence Length
807
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,998 Da
NCBI Official Full Name
Homo sapiens cell division cycle associated 3, mRNA
NCBI Official Synonym Full Names
cell division cycle associated 3
NCBI Official Symbol
CDCA3
NCBI Official Synonym Symbols
GRCC8; TOME-1
NCBI Protein Information
cell division cycle-associated protein 3
UniProt Protein Name
Cell division cycle-associated protein 3
Protein Family
UniProt Gene Name
CDCA3
UniProt Synonym Gene Names
C8; GRCC8; TOME1; TOME-1
UniProt Entry Name
CDCA3_HUMAN
Uniprot Description
CDCA3: F-box-like protein which is required for entry into mitosis. Acts by participating in E3 ligase complexes that mediate the ubiquitination and degradation of WEE1 kinase at G2/M phase.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 12p13
Cellular Component: intercellular junction
Molecular Function: protein binding
Research Articles on CDCA3
Similar Products
Product Notes
The CDCA3 cdca3 (Catalog #AAA1275647) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcag ccaagagcgt cccagtcaca ccagcgcggc ctccgccgca caacaagcat ctggctcgag tggcggaccc ccgttcacct agtgctggca tcctgcgcac tcccatccag gtggagagct ctccacagcc aggcctacca gcaggggagc aactggaggg tcttaaacat gcccaggact cagatccccg ctctcctact cttggtattg cacggacacc tatgaagacc agcagtggag accccccaag cccactggtg aaacagctga gtgaagtatt tgaaactgaa gactctaaat caaatcttcc cccagagcct gttctgcccc cagaggcacc tttatcttct gaattggact tgcctctggg tacccagtta tctgttgagg aacagatgcc accttggaac cagactgagt tcccctccaa acaggtgttt tccaaggagg aagcaagaca gcccacagaa acccctgtgg ccagccagag ctccgacaag ccctcaaggg accctgagac tcccagatct tcaggttcta tgcgcaatag atggaaacca aacagcagca aggtactagg gagatccccc ctcaccatcc tgcaggatga caactcccct ggcaccctga cactacgaca gggtaagcgg ccttcacccc taagtgaaaa tgttagtgaa ctaaaggaag gagccattct tggaactgga cgacttctga aaactggagg acgagcatgg gagcaaggcc aggaccatga caaggaaaat cagcactttc ccttggtgga gagctag. It is sometimes possible for the material contained within the vial of "CDCA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
