Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYTL1 cdna clone

SYTL1 cDNA Clone

Gene Names
SYTL1; JFC1; SLP1
Synonyms
SYTL1; SYTL1 cDNA Clone; SYTL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcaggaagaagagcaccaggggagaccaggctccaggccacgacagggaggctgaggctgctgtgaaagagaaggaagaggggccagagcccaggctcaccattgatgaggcccctcaggagaggctcagggagactgagggacctgatttcccatcgccttctgcccccctaaaggcttcagatcctgaggaggcgtcccaggcccaggaagatcctggccaaggagaccaacaggtctgtgccgaggaggctgacccggagctggagcccgcgtcggggggagagcaggagccgcggccccagcaagcccagaccaaggccgcgtcccagatcctggagaatggggaggaggccccggggcccgacccctctctcgaccgcatgctcagcagcagctcctcggtgtccagccttaactcctccacgctgagcggcagccagatgagcctgtcaggcgacgcggaggcggtgcaggtccgcggctccgtgcacttcgcgctgcactacgagccgggcgccgccgagctgcgcgtgcacgtgatccagtgccagggcctggccgccgcccggcgccgccgctcggacccctacgtcaaaagctacctcctcccggataagcagagcaagcgcaagacggcggtgaagaaacggaatctgaatccggttttcaacgagactctccggtactccgtcccgcaggccgagcttcagggccgcgtgctgagcctgtctgtgtggcaccgcgaaagcctgggtcgcaacatctttctgggcgaagttgaagtgcccctggacacgtgggactggggctctgagcccacctggctccccctgcagccccgggtcccaccctctcccgacgaccttccgagccgcgggttactcgccctgtccctcaagtacgtccccgccggctccgagggcgcaggactgcccccgagcggggagctgcacttctgggtgaaggaggctcgggacctcctgccgctgcgggcaggatccctggacacttacgtacaatgcttcgtgctgcctgatgacagccaggccagccgccagcgtacaagggttgtgcgacgcagcctcagccctgtgttcaatcacaccatggtgtacgatggctttgggcctgctgacctgcgccaggcttgtgccgagctctccctctgggaccatggggccctggccaaccgccagctggggggcacacgcctcagcctgggcaccggcagcagctatgggctgcaggtgccctggatggattccacacctgaggagaagcagctgtggcaagccctcctggagcagccgtgcgaatgggtggatggccttctacccctcagaaccaacctggcccccaggacgtag
Sequence Length
1374
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,635 Da
NCBI Official Full Name
Homo sapiens synaptotagmin-like 1, mRNA
NCBI Official Synonym Full Names
synaptotagmin like 1
NCBI Official Symbol
SYTL1
NCBI Official Synonym Symbols
JFC1; SLP1
NCBI Protein Information
synaptotagmin-like protein 1
UniProt Protein Name
Synaptotagmin-like protein 1
UniProt Gene Name
SYTL1
UniProt Synonym Gene Names
SLP1
UniProt Entry Name
SYTL1_HUMAN

Uniprot Description

SYTL1: May play a role in vesicle trafficking. Binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: extrinsic to plasma membrane; melanosome; plasma membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; neurexin binding; protein binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; exocytosis; regulation of calcium ion-dependent exocytosis; vesicle fusion

Research Articles on SYTL1

Similar Products

Product Notes

The SYTL1 sytl1 (Catalog #AAA1275640) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcagga agaagagcac caggggagac caggctccag gccacgacag ggaggctgag gctgctgtga aagagaagga agaggggcca gagcccaggc tcaccattga tgaggcccct caggagaggc tcagggagac tgagggacct gatttcccat cgccttctgc ccccctaaag gcttcagatc ctgaggaggc gtcccaggcc caggaagatc ctggccaagg agaccaacag gtctgtgccg aggaggctga cccggagctg gagcccgcgt cggggggaga gcaggagccg cggccccagc aagcccagac caaggccgcg tcccagatcc tggagaatgg ggaggaggcc ccggggcccg acccctctct cgaccgcatg ctcagcagca gctcctcggt gtccagcctt aactcctcca cgctgagcgg cagccagatg agcctgtcag gcgacgcgga ggcggtgcag gtccgcggct ccgtgcactt cgcgctgcac tacgagccgg gcgccgccga gctgcgcgtg cacgtgatcc agtgccaggg cctggccgcc gcccggcgcc gccgctcgga cccctacgtc aaaagctacc tcctcccgga taagcagagc aagcgcaaga cggcggtgaa gaaacggaat ctgaatccgg ttttcaacga gactctccgg tactccgtcc cgcaggccga gcttcagggc cgcgtgctga gcctgtctgt gtggcaccgc gaaagcctgg gtcgcaacat ctttctgggc gaagttgaag tgcccctgga cacgtgggac tggggctctg agcccacctg gctccccctg cagccccggg tcccaccctc tcccgacgac cttccgagcc gcgggttact cgccctgtcc ctcaagtacg tccccgccgg ctccgagggc gcaggactgc ccccgagcgg ggagctgcac ttctgggtga aggaggctcg ggacctcctg ccgctgcggg caggatccct ggacacttac gtacaatgct tcgtgctgcc tgatgacagc caggccagcc gccagcgtac aagggttgtg cgacgcagcc tcagccctgt gttcaatcac accatggtgt acgatggctt tgggcctgct gacctgcgcc aggcttgtgc cgagctctcc ctctgggacc atggggccct ggccaaccgc cagctggggg gcacacgcct cagcctgggc accggcagca gctatgggct gcaggtgccc tggatggatt ccacacctga ggagaagcag ctgtggcaag ccctcctgga gcagccgtgc gaatgggtgg atggccttct acccctcaga accaacctgg cccccaggac gtag. It is sometimes possible for the material contained within the vial of "SYTL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.