Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXL3 cdna clone

FBXL3 cDNA Clone

Gene Names
FBXL3; FBL3; FBL3A; FBXL3A
Synonyms
FBXL3; FBXL3 cDNA Clone; FBXL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaacgaggaggaagagatagtgaccgtaattcatcagaagaaggaactgcagagaaatccaagaaactgaggactacaaatgagcattctcagacttgtgattggggtaatctccttcaggacattattctccaagtatttaaatatttgcctcttcttgaccgggctcatgcttcacaagtttgccgcaactggaaccaggtatttcacatgcctgacttgtggagatgttttgaatttgaactgaatcagccagctacatcttatttgaaagctacccatccagagctgatcaaacagattattaaaagacattcaaaccatctacaatatgtcagcttcaaggtggacagcagcaaggaatcagctgaagcagcttgtgatatactatcgcaacttgtgaattgctctttaaaaacacttggacttatttcaactgctcgaccaagctttatggatttaccaaagtctcactttatctctgcactgacagttgtgttcgtaaactccaaatccctgtcttcgcttaagatagatgatactccagtagatgatccatctctcaaagtactagtggccaacaatagtgatacactcaagctgttgaaaatgagcagctgtcctcatgtctctccagcaggtatcctttgtgtggctgatcagtgtcacggcttaagagaactagccctgaactaccacttattgagtgatgagttgttacttgcattgtcttctgaaaaacatgttcgattagaacatttgcgcattgatgtagtcagtgagaatcctggacagacacacttccatactattcagaagagtagctgggatgctttcatcagacattcacccaaagtgaacttagtgatgtatttttttttatatgaagaagaatttgaccccttctttcgctatgaaatacctgccacccatctgtactttgggagatcagtaagcaaagatgtgcttggccgtgtgggaatgacatgccctagactggttgaactagtagtgtgtgcaaatggattacggccacttgatgaagagttaattcgcattgcagaacgttgcaaaaatttgtcagctattggactaggggaatgtgaagtctcatgtagtgcctttgttgagtttgtgaagatgtgtggtggccgcctatctcaattatccattatggaagaagtactaattcctgaccaaaagtatagtttggagcagattcactgggaagtgtccaagcatcttggtagggtgtggtttcccgacatgatgcccacttggtaa
Sequence Length
1287
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,707 Da
NCBI Official Full Name
Homo sapiens F-box and leucine-rich repeat protein 3, mRNA
NCBI Official Synonym Full Names
F-box and leucine rich repeat protein 3
NCBI Official Symbol
FBXL3
NCBI Official Synonym Symbols
FBL3; FBL3A; FBXL3A
NCBI Protein Information
F-box/LRR-repeat protein 3
UniProt Protein Name
F-box/LRR-repeat protein 3
UniProt Gene Name
FBXL3
UniProt Synonym Gene Names
FBL3A; FBXL3A
UniProt Entry Name
FBXL3_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats and is localized in the nucleus. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXL3: Substrate-recognition component of some SCF (SKP1-CUL1- F-box protein)-type E3 ubiquitin ligase complex involved in circadian clock function. The SCF(FBXL3) complex acts by mediating ubiquitination and subsequent degradation of CRY1 and CRY2. Recruiter of target protein that may recognize and bind to some phosphorylated proteins and promotes their ubiquitination and degradation.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 13q22

Cellular Component: cytosol; nucleus; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: entrainment of circadian clock by photoperiod; protein destabilization; protein ubiquitination; regulation of circadian rhythm; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process

Research Articles on FBXL3

Similar Products

Product Notes

The FBXL3 fbxl3 (Catalog #AAA1275611) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacgag gaggaagaga tagtgaccgt aattcatcag aagaaggaac tgcagagaaa tccaagaaac tgaggactac aaatgagcat tctcagactt gtgattgggg taatctcctt caggacatta ttctccaagt atttaaatat ttgcctcttc ttgaccgggc tcatgcttca caagtttgcc gcaactggaa ccaggtattt cacatgcctg acttgtggag atgttttgaa tttgaactga atcagccagc tacatcttat ttgaaagcta cccatccaga gctgatcaaa cagattatta aaagacattc aaaccatcta caatatgtca gcttcaaggt ggacagcagc aaggaatcag ctgaagcagc ttgtgatata ctatcgcaac ttgtgaattg ctctttaaaa acacttggac ttatttcaac tgctcgacca agctttatgg atttaccaaa gtctcacttt atctctgcac tgacagttgt gttcgtaaac tccaaatccc tgtcttcgct taagatagat gatactccag tagatgatcc atctctcaaa gtactagtgg ccaacaatag tgatacactc aagctgttga aaatgagcag ctgtcctcat gtctctccag caggtatcct ttgtgtggct gatcagtgtc acggcttaag agaactagcc ctgaactacc acttattgag tgatgagttg ttacttgcat tgtcttctga aaaacatgtt cgattagaac atttgcgcat tgatgtagtc agtgagaatc ctggacagac acacttccat actattcaga agagtagctg ggatgctttc atcagacatt cacccaaagt gaacttagtg atgtattttt ttttatatga agaagaattt gaccccttct ttcgctatga aatacctgcc acccatctgt actttgggag atcagtaagc aaagatgtgc ttggccgtgt gggaatgaca tgccctagac tggttgaact agtagtgtgt gcaaatggat tacggccact tgatgaagag ttaattcgca ttgcagaacg ttgcaaaaat ttgtcagcta ttggactagg ggaatgtgaa gtctcatgta gtgcctttgt tgagtttgtg aagatgtgtg gtggccgcct atctcaatta tccattatgg aagaagtact aattcctgac caaaagtata gtttggagca gattcactgg gaagtgtcca agcatcttgg tagggtgtgg tttcccgaca tgatgcccac ttggtaa. It is sometimes possible for the material contained within the vial of "FBXL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.