Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CUEDC2 cdna clone

CUEDC2 cDNA Clone

Gene Names
CUEDC2; C10orf66; bA18I14.5
Synonyms
CUEDC2; CUEDC2 cDNA Clone; CUEDC2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctggagaggatcgtcagtgcagccctccttgcctttgtccagacacacctcccggaggccgacctcagtggcttggatgaggtcatcttctcctatgtgcttggggtcctggaggacctgggcccctcgggcccatcagaggagaacttcgatatggaggctttcactgagatgatggaggcctatgtgcctggcttcgcccacatccccaggggcacaataggggacatgatgcagaagctctcagggcagctgagcgatgccaggaacaaagagaacctgcaaccgcagagctctggtgtccaaggtcaggtgcccatctccccagagcccctgcagcggcccgaaatgctcaaagaagagactaggtcttcggctgctgctgctgcagacacccaagatgaggcaactggcgctgaggaggagcttctgccaggggtggatgtactcctggaggtgttccctacctgttcggtggagcaggcccagtgggtgctggccaaagctcggggggacttggaagaagctgtgcagatgctggtagagggaaaggaagaggggcctgcagcctgggagggccccaaccaggacctgcccagacgcctcagaggcccccaaaaggatgagctgaagtccttcatcctgcagaagtacatgatggtggatagcgcatag
Sequence Length
681
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,009 Da
NCBI Official Full Name
Homo sapiens CUE domain containing 2, mRNA
NCBI Official Synonym Full Names
CUE domain containing 2
NCBI Official Symbol
CUEDC2
NCBI Official Synonym Symbols
C10orf66; bA18I14.5
NCBI Protein Information
CUE domain-containing protein 2
UniProt Protein Name
CUE domain-containing protein 2
UniProt Gene Name
CUEDC2
UniProt Synonym Gene Names
C10orf66
UniProt Entry Name
CUED2_HUMAN

Uniprot Description

CUEDC2: Down-regulates ESR1 protein levels through the ubiquitination-proteasome pathway, regardless of the presence of 17 beta-estradiol. Also involved in 17 beta-estradiol-induced ESR1 degradation. Controls PGR protein levels through a similar mechanism. May predict the clinical outcome of tamoxifen therapy of breast cancer patients. Patients with tumors that highly express CUEDC2 do not respond to tamoxifen treatment as effectively as those with tumors with low expression. Belongs to the CUEDC2 family.

Chromosomal Location of Human Ortholog: 10q24.32

Cellular Component: cytoplasm; nuclear membrane; nucleoplasm

Molecular Function: protein binding

Research Articles on CUEDC2

Similar Products

Product Notes

The CUEDC2 cuedc2 (Catalog #AAA1275428) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgg agaggatcgt cagtgcagcc ctccttgcct ttgtccagac acacctcccg gaggccgacc tcagtggctt ggatgaggtc atcttctcct atgtgcttgg ggtcctggag gacctgggcc cctcgggccc atcagaggag aacttcgata tggaggcttt cactgagatg atggaggcct atgtgcctgg cttcgcccac atccccaggg gcacaatagg ggacatgatg cagaagctct cagggcagct gagcgatgcc aggaacaaag agaacctgca accgcagagc tctggtgtcc aaggtcaggt gcccatctcc ccagagcccc tgcagcggcc cgaaatgctc aaagaagaga ctaggtcttc ggctgctgct gctgcagaca cccaagatga ggcaactggc gctgaggagg agcttctgcc aggggtggat gtactcctgg aggtgttccc tacctgttcg gtggagcagg cccagtgggt gctggccaaa gctcgggggg acttggaaga agctgtgcag atgctggtag agggaaagga agaggggcct gcagcctggg agggccccaa ccaggacctg cccagacgcc tcagaggccc ccaaaaggat gagctgaagt ccttcatcct gcagaagtac atgatggtgg atagcgcata g. It is sometimes possible for the material contained within the vial of "CUEDC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.